Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1339 | 30522085 | 2019 | A label-free impedimetric aptasensor for the detection of Bacillus anthracis spore simulant | BAS-6R | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus (ATCC 11778 and ATCC 14579) | B. anthracis spore simulant (B. cereus spore 14579) | Developed an impedimetric DNA-based aptasensor based on an aptamer immolized on a gold screen-printed electrode for a single-step detection of B. cereus spores. | Spores were detected with a linear range between 10(4) CFU/ml and 5 × 10(6) CFU/ml and a detection limit of 3 × 10(3) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |