Target : β-structure of membrane associated protein

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0397	24018905	2014	Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development	SMa#G11-5	ATACATCTTAAGTCTCGTGGGGGGAGGGGGGGTTGGTGGGCTTT	44	N/A	ssDNA	Streptococcus Mutans (ATCC 25175 and JCM 5175)	β-structure of membrane associated protein	Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids.	Colorimetric assay demonstrated detection of S. mutans cells at a concentration range of 1 × 10(5)-10(8) CFU/mL.	11	Flow Cytometry	33 nM	Detection	In Silico Maturation (ISM)	5'-Thiolated	N/A	N/A	Best Candidate	N/A	N/A
ABdb_0398	24018905	2014	Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development	SMa#G11-6	ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT	47	N/A	ssDNA	Streptococcus Mutans (ATCC 25175 and JCM 5175)	β-structure of membrane associated protein	Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids.	Showed the highest binding signals to S. mutans with a 16-fold increase over SMa#3-6-P1.	11	Flow Cytometry	33 nM	Detection	In Silico Maturation (ISM)	5'-Fluorescein Labeled	N/A	N/A	Best Candidate	N/A	N/A