Target : (1 → 3)-β-D-glucans

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0974	27951452	2017	(1→3)-β-D-glucan aptamers labeled with technetium-99m: Biodistribution and imaging in experimental models of bacterial and fungal infection	Seq6	CGACTGACGCCTCCAAGCCACACGTGTGAGAAGGGTGTTATCATGTATTTCGTGTTCCTTTCGTCATTCCTTTGTCTGCATGCATCGCTACGTG	94	N/A	ssDNA	Staphylococcus aureus (S. aureus) (ATCC 25923)	(1 → 3)-β-D-glucans	Radiolabeled aptamers were evaluated to identify infectious foci caused by bacterial cells.	The target/non-target ratios were 3.17 ± 0.22 for seq6 in S. aureus-infected animals.	N/A	N/A	0.303 ± 0.067 μM	Imaging	N/A	5'-Radiolabelled (99mTc labeled)	N/A	In vitro stability of seq6 aptamer labelled with 99mTc in the presence of 0.9% saline, plasma, and cysteine excess (molar ratio) was above 84.2 ± 2.9% in all cases at 24hrs.	N/A	N/A	N/A