Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 2
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1445 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.02 (ID 6) | TTTTTAAGCCCACCYCGCYGTGCAAGGCGAACGCCATCAGTGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |
| ABdb_1447 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.04 (ID 8) | TTTTTAACACGACCCCACYGTGCGAGCCGAACACCACCACGGTGGGCCCATG | 52 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG | N/A | N/A | N/A | N/A | N/A |