AptBacterialDB

Modification : Y = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATG

Total records found: 2

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1445 327246452020Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticusS.184004.T1.02 (ID 6)TTTTTAAGCCCACCYCGCYGTGCAAGGCGAACGCCATCAGTGTGGGCCCATG52N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellIdentify high‐affinity aptamers that specifically recognize Vp.N/A2Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionAM X‐aptamer kitY = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATGN/AN/AN/AN/AN/A
ABdb_1447 327246452020Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticusS.184004.T1.04 (ID 8)TTTTTAACACGACCCCACYGTGCGAGCCGAACACCACCACGGTGGGCCCATG52N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellIdentify high‐affinity aptamers that specifically recognize Vp.N/A2Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)N/ADetectionAM X‐aptamer kitY = phenol‐dU, five additional Ts at the 5'‐end, and 3'-CCATGN/AN/AN/AN/AN/A