Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1811 | https://doi.org/10.3390/fishes8100477 | 2023 | A Novel Method for Sensitive Detection of Vibrio alginolyticus Based on Aptamer and Hybridization Chain Reaction in Aquaculture | Aptamer | GAGAGAGAATATAAGGGAAAAAAAATCAGTCGCTTCGCCGTCTCCTTCGGGGGCGCGGTGAGGGGCTGCACAAGAGGGAGGCACAAGAGGGAGACCCCAGAGGG | 104 | N/A | ssDNA | Vibrio Alginolyticus (ATCC 17749) | Whole cell | Developed a method using an HCR-based multivalent aptamer (multi-Apt) for the detection of Vibrio alginolyticus. | Obtained a linear range from 10 to 10(7) CFU/mL, and the limit of detection (LOD) is 3 CFU/mL. | N/A | N/A | N/A | Detection | N/A | SA-HRP or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |