Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 444
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0058 | 19751419 | 2009 | Antibiotic resistance in bacteria: novel metalloenzyme inhibitors | Metallo-β-lactamase-targeting aptamers | CGCGAGCTCCGCGCG-AACCAAACTTGGATCGGTGCACATGTCGAA-CGCGCGCATATGGCGC | 61 | 5'-CGCGAGCTCCGCGCG-N30-CGCGCGCATATGGCGC-3' | ssDNA | Bacillus Cereus 5/B/6 and Escherichia Coli (E. Coli) TAP56 | Metallo-β-lactamase active sites | Identify aptamers that bind and inhibit the hydrolytic enzyme activity by interfering with the active-site metal ions of the β-lactamase enzyme. | LC50 values in the presence of 5 μM cephalexin: 75 μM and 32 μM for B. cereus 5/B/6 and E. coli TAP56, respectively. | 21 | Metallo-β-lactamase activity assays | Ki = 0.92 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0103 | 21743920 | 2011 | Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties | 1–PA | GCGCGGATCCCGCGC-GATGTGGGTGTAGTTGGAGGGTAAACGTT-CGCGCGAAGCTTGCG | 59 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Protective antigen (PA) of anthrax toxin | Detection of PA based on the reduction in the fluorescence emission according to the formation of the aptamer-PA ternary complex. | The limit of PA detection using this system was determined to be approximately 1 nM. | 8 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 8.53 nM | Biosensor | SELEX | N/A | N/A | N/A | N/A | N/A | Korea Pat., KR101152354B1 (2012-06-13) |
| ABdb_0104 | 21743920 | 2011 | Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties | 2–PA | GCGCGGATCCCGCGC-CAGACCGTAAGGGATGCCGCCTAAACACC-CGCGCGAAGCTTGCG | 59 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3' | ssDNA | Bacillus Anthracis (BA) | Protective antigen (PA) of anthrax toxin | Detection of PA based on the reduction in the fluorescence emission according to the formation of the aptamer-PA ternary complex. | The limit of PA detection using this system was determined to be approximately 1 nM. | 8 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 1.51 nM | Biosensor | SELEX | N/A | N/A | N/A | N/A | N/A | Korea Pat., KR101152354B1 (2012-06-13) |
| ABdb_0136 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A1 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0137 | 23190695 | 2012 | Aptasensors for rapid detection of Escherichia coli O157:H7 and Salmonella typhimurium | A2 | CCAAAGGCTACGCGTTAACGTGGTGTTGG | 29 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | Aptasensors based on label-free aptamers and gold nanoparticles (AuNPs) for the detection of E. coli O157:H7 and Salmonella typhimurium. | Detects as low as 10(5) CFU/ml of target bacteria within 20 min or less, with 100% specificity. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0186 | https://doi.org/10.1002/elan.201100700 | 2012 | A Rapid and Sensitive Aptamer-Based Electrochemical Biosensor for Direct Detection of Escherichia Coli O111 | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O111 | Lipopolysaccharide (LPS) | Developed an electrochemical biosensor based on target-induced aptamer displacement for the detection of E. coli O111. | Achieved a detection limit of 112 CFU/mL in PBS and 305 CFU/mL in milk within 3.5 hours. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0187 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-1 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0188 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-2 | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0189 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-3 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0190 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-4 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0191 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-5 | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0192 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-6 | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0193 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-7 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0194 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-8 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0196 | 22971146 | 2012 | Aptamer-based impedimetric sensor for bacterial typing | SENT-10 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Development of an aptamer-based impedimetric sensor for the typing of bacteria (AIST-B). | N/A | 12 | N/A | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0233 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt10 | GAATTCAGTCGGACAGCG-GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG-GATGGACGAATATCGTCTCCC | 83 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 73 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0234 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 45 | GAATTCAGTCGGACAGCG-ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC-GATGGACGAATATCGTCTCCC | 79 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 68 ± 6 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0235 | 23698275 | 2013 | Highly specific and cost-efficient detection of Salmonella Paratyphi A combining aptamers with single-walled carbon nanotubes | Apt 60 | GAATTCAGTCGGACAGCG-CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG-GATGGACGAATATCGTCTCCC | 76 | 5'-GAATTCAGTCGGACAGCG-N40-GATGGACGAATATCGTCTCCC-3' | ssDNA | Salmonella Paratyphi A | Whole cell | Identify aptamers that bind to and detect S. Paratyphi A based on the noncovalent self-assembly of individual SWNTs and DNAzyme-labelled aptamer detection probe. | N/A | 17 | Fluorescence Spectroscopy | 56 ± 9 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0242 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 1 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTCTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0243 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 2 | GCAATGGTACGGTACTTCC-CAACCCCGTCTATCACGTCGCTGTTGCGTTGGTTG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 7.5 ~ 10 nM (for ALS) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0244 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 3 | GCAATGGTACGGTACTTCC-CGCCGCCGCGTTCTCATCGCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 17.5 ~ 20 nM (for ALS) and 30 ~ 35 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0245 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 4 | GCAATGGTACGGTACTTCC-CGCCGGCTTCTCTTGCCGTGATGTAGTGTCCG-CAAAAGTGCACGCTACTTTGCTAA | 75 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 nM (for ALS) and 20 ~ 25 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0246 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 5 | GCAATGGTACGGTACTTCC-CGGGGCCCGCTTCTGGTGCGGTGTACTAGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | ALSap-5 at 0.5 µM, about 90% of biofilm, 50.9% reduced pyocyanin secretions, as well as secretions of LasA protease and LasB elastase were inhibited. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 ~ 12.5 nM (for ALS) and 20 nM (for 3O-C12-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0247 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 6 | GCAATGGTACGGTACTTCC-CGGGGCGGGCTGTCATGCCCATCCTACCGTGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 15 ~ 17.5 nM (for ALS) and 45 ~ 50 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0248 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 7 | GCAATGGTACGGTACTTCC-CGGGGCGGCCTGTGTTGGCCTACCTAGCGAGACCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | N/A | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 12.5 ~ 15 nM (for ALS) and 35 ~ 40 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_0249 | https://doi.org/10.1007/s12257-012-0556-6 | 2013 | Screening and anti-virulent study of N-acyl homoserine lactones DNA aptamers against Pseudomonas aeruginosa quorum sensing | ALSap 8 | GCAATGGTACGGTACTTCC-CGCTGCCCCCTGTCCTGGGTTAGCTAGCGAGAGCG-CAAAAGTGCACGCTACTTTGCTAA | 78 | 5'-GCAATGGTACGGTACTTCC-N35-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Amino lactam surrogate (ALS) of N-acyl homoserine lactone (HSL) | DNA aptamers that bind specifically to HSL and show strong inhibitory activity on biofilm formation. | 86% of pyocyanin secretion was inhibited by 6 µM of ALSap-8, and biofilm formation, and the secretions of LasA protease and LasB elastase were also decreased by 9.3%, 17.5%, and 19% respectively. | 14 | Enzyme-Linked Immunosorbent Assay (ELISA) | 10 nM (for ALS) and 25 ~ 30 nM (for C4-HSL) | Therapeutics | SELEX | N/A | Aptamers had no influence on bacterial growth. | N/A | Best Candidate | N/A | N/A |
| ABdb_0289 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA101 | ATTACTTACGCTATCTAAttt-GGGGGGTGGGTTGTTTGGGATGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0290 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA102 | ATTACTTACGCTATCTAAttt-GGGGGGGGAACATGTTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 3.5 nM (for B4) and 1.4 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0291 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA103 | ATTACTTACGCTATCTAAttt-GGGGCGGGACTTATTTGGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0292 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA104 | ATTACTTACGCTATCTAAttt-GGGGGTGGGTGCTTTTGTGGTGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0293 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA105 | ATTACTTACGCTATCTAAttt-TAGGGGTGGGTTCAATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0294 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA106 | ATTACTTACGCTATCTAAttt-GGGGGGCGGGTATTAATGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0295 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA107 | ATTACTTACGCTATCTAAttt-GTTTTCGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0296 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA108 | ATTACTTACGCTATCTAAttt-GCACTAAAGGGGAGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0297 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA109 | ATTACTTACGCTATCTAAttt-TTGCTTTAGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | 7.7 nM (for B4) and 4.1 nM (for DL1d-A6) | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0298 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA110 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0299 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA111 | ATTACTTACGCTATCTAAttt-GCCCGATGGGGGTGGCGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0300 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G02 | ATTACTTACGCTATCTAAttt-TTGCTGTAGGGGAGGAGGGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Displayed the highest specificity, exhibiting a 36% higher specificity index than that of the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0301 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G19 | ATTACTTACGCTATCTAAttt-TTTTTCGGGGGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0302 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G14 | ATTACTTACGCTATCTAAttt-TTGCTTTAGAGGAGGCGGGTGGAG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0303 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G11 | ATTACTTACGCTATCTAAttt-TCGGTGATGGGGAGGAGGCGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0304 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G03 | ATTACTTACGCTATCTAAttt-GTTTTATGGGGGTGGCGTGTGGCG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0305 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G06 | ATTACTTACGCTATCTAAttt-TCGCTGATGGGGAGGAGCGTGGGT-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0306 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G10 | ATTACTTACGCTATCTAAttt-TTACTTTTGGGGGGGCGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0307 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G02 | ATTACTTACGCTATCTAAttt-GCACGTTTGGGGAGGTTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0308 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G09 | ATTACTTACGCTATCTAAttt-TTTTTCGAGGGGAGATTGGGGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0309 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G20 | ATTACTTACGCTATCTAAttt-GCGCGAGTGGGGGGGTGGGTGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0310 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G04 | ATTACTTACGCTATCTAAttt-GCCCGCGTCGGGGGGTGGGGGGTC-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0311 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA1G01 | ATTACTTACGCTATCTAAttt-TCGCTATGGGGGTGGCGGCTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | Showed up to 26% higher specificity index compared with the original PmA109. | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0312 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G17 | ATTACTTACGCTATCTAAttt-TAGCTTTAGGGGTCGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0313 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G08 | ATTACTTACGCTATCTAAttt-GAGCTTTAGAGGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0314 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G04 | ATTACTTACGCTATCTAAttt-TTCCTTGGGGAGTGGTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0315 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G06 | ATTACTTACGCTATCTAAttt-GTTTTCGGGGGCTGGTGGTTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0316 | 23568752 | 2013 | In silico maturation of binding-specificity of DNA aptamers against Proteus mirabilis | PmA2G09 | ATTACTTACGCTATCTAAttt-TGGCTCGGGGGGTGTTGGGTGGGG-tttTTATCATCTGGTATGTTA | 66 | 5'-ATTACTTACGCTATCTAAttt-N24-tttTTATCATCTGGTATGTTA-3' | ssDNA | Proteus Mirabilis (B4 and DL1d-A6 cells) | Whole cell | Identify aptamers that show high affinity for P. mirabilis and improved affinity using ISM. | N/A | 6 | Bioluminescence-based Membrane Blotting Assay | N/A | Detection | Whole Cell-SELEX with In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0399 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#3-6-P1 | ATACCAGCTTATTCAATTGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGCCGC | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 3 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0400 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-20 | CTACGTCTAGATTCCAGTCGAGGGGGGAGGGGGGGTTTTGGATCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0401 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G10-11 | CAACCTGCTTATCTAAGGGGGGGAGGGGGGGTTGTGGGTAGGT | 43 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 10 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0402 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G2-1 | CTAGCAGTTCATTCAATAGGGGGGACGGGGGGTTAGGCTAGACTATGTCTAATCA | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 2 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0403 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G5-5 | ATACACGTAAGTACCATTGGGCGGGGGGGGTGTTGTTTTCTACTATGTGCAATCG | 55 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 5 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0404 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-8 | ACACCACTTAATTCCATGCGAGGGGGGAGGGGGGGTTCGGGGACGGC | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 11 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0405 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G43 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-AAUAGGAACUUAGAACAACCCUCUCCCUCAUGUAGCGAACCCGAACCAGG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | The affinity of aptamer G43 to EsxG was about ten times higher than the affinity of aptamer G78 and also showed no significant binding to EsxA. | 5 | Surface Plasmon Resonance (SPR) | 8.04 ± 1.9 nM | Detection | SPR based SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0406 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G78 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-GCGUUUAAACGUUGCACCGUCGUUGACGGGACCGCUUGAGACAUUCGCUC-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | G78 showed some binding to EsxA, though a significantly lower binding signal was observed (p < 0.01) when compared to that of EsxG. | 5 | Surface Plasmon Resonance (SPR) | 78.85 ± 9.4 nM | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0407 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G31 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-UAACGACUCACCAACACAUCGACUAAUUUCCCUAAAUGACUUAACUGAAU-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | N/A | 5 | Surface Plasmon Resonance (SPR) | N/A | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0408 | 24813997 | 2014 | Selection of RNA aptamers against the M. tuberculosis EsxG protein using surface plasmon resonance-based SELEX | G70 | UAAUACGACUCACUAUAGGGAGACAAGACUAGACGCUCAA-ACUCGUGACACUUACGAACGACCUAUGGCGGGAGAAUCCUAGCCGCUACG-UUCGACAUGAGACUCACAACAGUUCCCUUUAGUGAGGGUUAAUU | 134 | N/A | ssRNA | Mycobacterium Tuberculosis (H37Rv) | EsxG protein | Identify aptamers against EsxG over its homologue EsxA. | N/A | 5 | Surface Plasmon Resonance (SPR) | N/A | Detection | SPR based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0433 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | ST-apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A universal fluorescent aptasensor based on the AccuBlue dye was developed for the detection of pathogenic bacteria. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 25 cfu/mL in 1.5 h for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0434 | 24650583 | 2014 | A universal fluorescent aptasensor based on AccuBlue dye for the detection of pathogenic bacteria | VP-apt | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer is hybridized with complementary DNA (cDNA) to form fluorescent dsDNA. | Exhibit a linear concentration range of 50 to 10(6) cfu/mL, and the LOD was 35 cfu/mL in 1.5 h for V. parahaemolyticus. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0445 | 25220163 | 2014 | Potentiometric Aptasensing of Listeria monocytogenes Using Protamine as an Indicator | LM aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Internalin A (InlA) | Develop a label-free potentiometric aptasensor for selective detection of L. monocytogenes. | LM can be detected down to 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0467 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Amplify-aptamer (a-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0506 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 36 | CCGTCAGCCGAGGACCACAC-TTGGTTGCTGAATCCCCTCGTCTTGGCTTTCTTTGTCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | Mtb36 aptamer bound to M. tuberculosis H37Ra bacteria more than 4 times for M. bovis and 70 times for E. coli bacteria. | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5.09 ±1.43 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0507 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 17 | CCGTCAGCCGAGGACCACAC-GCGTCAATATGCTCGAGTCCCTTACTCCGTAATCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0508 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 57 | CCGTCAGCCGAGGACCACAC-GAGGCGGGGCGTACATGATGGAGGTGTTGTGTTCTTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0509 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 25 | CCGTCAGCCGAGGACCACAC-ATAGGAAGTATGCGGTCGTAGTTAATCGCCTGTCCTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0510 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 32 | CCGTCAGCCGAGGACCACAC-CTGGGCTCACTCACTGGCGTATCATTCGTCCGCGGTGGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0511 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 3 | CCGTCAGCCGAGGACCACAC-CGCTTCACGTGTCAGTGAATTTTCTCCATCGTTTGGTGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0512 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 40 | CCGTCAGCCGAGGACCACAC-TGTAGCGCATCTACGGGCTCTTCATTACGTCTATATCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0513 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 33 | CCGTCAGCCGAGGACCACAC-TTCACACACGGGTATAAACGCTCTGGTATGTCAAGCCGGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0514 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 35 | CCGTCAGCCGAGGACCACAC-TCGGACCTAGTGCTAGGGTCTCTAAGAAGTATCGGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0515 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 49 | CCGTCAGCCGAGGACCACAC-TTCTCCGATCTTAGTCAACTTGGACCATGAATGCGGGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0516 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 46 | CCGTCAGCCGAGGACCACAC-TATTTACGCTGACCGACGATTTTCTATCAGAGTGCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0517 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 13 | CCGTCAGCCGAGGACCACAC-CGATCACTGTACAGTCCTGGATAAGCCGTTCTTTCCGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0518 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 11 | CCGTCAGCCGAGGACCACAC-CGCCGGCCTTCTTACAAGACCTGTTCAATTCCCAGTGTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0519 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 50 | CCGTCAGCCGAGGACCACAC-AGGCTCACGCCCTGTCAATACTGCCTCTTGTCCTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0520 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 38 | CCGTCAGCCGAGGACCACAC-ATTCGGCTGAAGACCCGAGCCGGTCATCCGGTGTTCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0521 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 28 | CCGTCAGCCGAGGACCACAC-CTCCATCACGTGTAGTCAGCTGACCATTGATCGTGCCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0522 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 8 | CCGTCAGCCGAGGACCACAC-CTATCCCGTGGTCCATTGCTTTTCCCGGTCTCTTCTCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0523 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 52 | CCGTCAGCCGAGGACCACAC-CTTTGTGCCGGGAAAAGACTGGCCTGTGTTGACTTGCTGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0524 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 2 | CCGTCAGCCGAGGACCACAC-CGGCGCTTTTCTCATCCTACCTCCGCTCTTACCTGTATGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0525 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 9 | CCGTCAGCCGAGGACCACAC-GCCGTGCTGAGTCTGTCAGCAGTTTGCTAGTCTTCCCTGC-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0526 | 26541162 | 2015 | Selection of Nucleic Acid Aptamers Specific for Mycobacterium tuberculosis | Mtb 44 | CCGTCAGCCGAGGACCACAC-TTACACGAAGGCTCGGCCCATCTCTCTCGTGTCACTTCGG-TTGGGTGCAATGAAT | 75 | 5'-CCGTCAGCCGAGGACCACAC-N40-TTGGGTGCAATGAAT-3' | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Whole cell | Identify aptamer that specifically binds to M. tuberculosis H37Ra. | N/A | 7 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0628 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA1 | UUCAGGGACCAGUGUUUGCCUUGUGCCAGUC | 31 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 108 ± 33.4 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0629 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA2 | CCCAUAGUGAGUCGUAUUAAUUG | 23 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 296 ± 57.1 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0630 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA3 | GCGACCCUAUAGUGAGUCGUAUUAAUGCGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 388 ± 79.2 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0631 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA4 | GCGCCCCUAUAUGAGUCGUAUUAAUUGCGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | IC50 value is higher than 15 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 105 ± 10.9 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0632 | 25841381 | 2015 | Development of receptor-based inhibitory RNA aptamers for anthrax toxin neutralization | ABA5 | GCGCCCCCAUAGUGAGUCGUAUUAAUACGC | 30 | 5'-GCGCGGATCCCGCGC-N30-CGCGCGA AGCTTGCG-3' | ssRNA | Bacillus Anthracis (BA) | Anthrax toxin (ATR/TEM8 Von Willebrand factor type A (VWA) domain) | Identify aptamers that bind to the anthrax toxin receptor (ATR), which blocks the binding of PA to its receptor, in order to neutralize anthrax toxin. | ABA 5 rescued cells to at least 50% maximum cell viability, with an IC50 value of 5 μM. | 8 | Ribogreen dye-based fluorescence intensity assay | 205 ± 69.8 nM | Therapeutics | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0657 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.02 | TGTACCGTCTGAGCGATTCGTAC-TACGCCACACGTGGTGAGGGATTCGATCGCTTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0658 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.20 | TGTACCGTCTGAGCGATTCGTAC-TGCTATTCATCACCACTCTAGAGCCACTTTTAAA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0659 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.22 | TGTACCGTCTGAGCGATTCGTAC-TGGGCGGCGAGCCACCCGGCAATTTAGTACAGGC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0660 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.36 | TGTACCGTCTGAGCGATTCGTAC-AAAGCATCCAGCCGGTATGTGCCAGAGTCTCTGA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0661 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.38 | TGTACCGTCTGAGCGATTCGTAC-AAATGTGAGTGGCCAGGCATCAGGTACGTCGGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0662 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.03 | TGTACCGTCTGAGCGATTCGTAC-GGATAGGTGCCTCTGCTTCATCATGTTGAACTTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0663 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.13 | TGTACCGTCTGAGCGATTCGTAC-AGTTTCACCAGTCGCCTGTTAGCCGTGATATACG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0664 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.27 | TGTACCGTCTGAGCGATTCGTAC-TGTCAATATTACGTTGCTCTTAGGTTCACCATCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0665 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.28 | TGTACCGTCTGAGCGATTCGTAC-TTGTGATTCAAATAGGCGTGTTGGTGTGAGACCT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0666 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.23 | TGTACCGTCTGAGCGATTCGTAC-CGTGGATCATGCTTCGCGTCGGTTTATAGGTTCC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0667 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.39 | TGTACCGTCTGAGCGATTCGTAC-AGAAGAGCATCGGTAACTTCCATAGGAGATGGGG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0668 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.06 | TGTACCGTCTGAGCGATTCGTAC-CATCCGAGGGTATTGTATGCGTATATCCTAGTCG-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0669 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.10 | TGTACCGTCTGAGCGATTCGTAC-CAAGTTCCTCATGGAGGGTGCTCAGAGCTTAGAC-AGCCAGTCAGTGTTAAGGAGTAA | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0670 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.34 | TGTACCGTCTGAGCGATTCGTAC-AGGGGGATTCCTAGGGCCCGGCCCAACGCTGTTT-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0671 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.42 | TGTACCGTCTGAGCGATTCGTAC-CAAGACCCTTGAATCACGGGTAGGGTCTCGTAAC-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | N/A | 14 | N/A | N/A | Diagnostic | Decoy-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0694 | 25702275 | 2015 | A sensitive lateral flow biosensor for Escherichia coli O157:H7 detection based on aptamer mediated strand displacement amplification | Amplification-aptamer (a-aptamer) | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGT | 49 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Outer membrane protein (OMP) | Developed a Lateral Flow Biosensor (LFB) with gold nanoparticle (AuNP) probes for the detection of E.coli. | Can detect as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0699 | 25461175 | 2015 | A new aptamer/graphene interdigitated gold electrode piezoelectric sensor for rapid and specific detection of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed an aptamer/graphene interdigitated gold electrode piezoelectric sensor to detect Staphylococcus aureus. | Achieved a detection limit of 41 cfu/mL with a linear range of 4.1×10(1) to 4.1×10(5) cfu/mL. The detection is rapid, completing in less than 60 minutes. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0705 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 4 Rev | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0706 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | EcO 3 Rev | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | Exhibited a linear range of 10-10(4) cfu/mL and the detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0707 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0708 | https://doi.org/10.1039/C4AY02662D | 2015 | A chronopotentiometric flow injection system for aptasensing of E. coli O157 | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157 (ATCC 35150) | Whole cell | Develop a potentiometric aptasensor employing simple flow injection analysis system for the detection of E. coli O157. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0722 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 10 | GATGATGGACGTATATCGTCTCCCATGAATTCAGTCGGACAGCG | 44 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0723 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 22 | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG | 41 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0724 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 45 | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGC | 40 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0725 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 60 | CGCCCACCCATAATGGATCAGGGCGGGCACCACGATG | 37 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0726 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 1 | CGAAGGGGCTATGCCGCCTACATAGACCGTCACGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0727 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 2 | GGCCGGCAATACGGCCGAGCCCGGGGTTCCTCCGA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0728 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 3 | GCCACGCGCAGCAATCAAACCCGGCCCCCTGCTCC | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0729 | https://doi.org/10.1039/C5AY02298C | 2015 | Highly sensitive fluorescent aptasensor for Salmonella paratyphi A via DNase I-mediated cyclic signal amplification | Apt 4 | TGGCCAGAGTACGAGTAAGGGAGGTCACAACCTTA | 35 | N/A | ssDNA | Salmonella Paratyphi A | Whole cell | Developed an aptasensor composed of a designed aptamer (DA) and two short FAM-modified sequences (probe 1 and probe 2) for fluorimetric determination of S. paratyphi A via DNase I-mediated cyclic signal amplification. | Obtained a concentration ranging from 1 × 10(2) to 1 × 10(11) cells/mL with a detection limit of 1 × 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0732 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL33 | TAGCTCACTCATTAGGCA-CTCGTATTGAGGAGCTCGTATTATTTAATTCACACTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 221 ± 72 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0734 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL43 | TAGCTCACTCATTAGGCA-CGAGACCACCGGCAACCTTTCACAAAGGGGAGGCTAA-GCATAGTTAAGCCAGCC | 72 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 112 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0735 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL21 | TAGCTCACTCATTAGGCA-CAGCAACTCGCTTTGATACCGGTAGAGTTTGTATTGCTCAA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0736 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL37 | TAGCTCACTCATTAGGCA-CTTAGTTCAGACGCGAGTATTATCGGCGTCCAAGCAAGGG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0737 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL20 | TAGCTCACTCATTAGGCA-CATATTCAGCAGTTGTATGATAGCGGGTCGCGAGTGTGTAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0738 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL40 | TAGCTCACTCATTAGGCA-CTGCATTACATATATGGCAGTGGGTTAACCTGGATTGAGGA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 204 ± 73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0739 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL16 | TAGCTCACTCATTAGGCA-CCCGATTGTACTAATGAAGATGGACACTGAGAGGGGGATGG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0741 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL45 | TAGCTCACTCATTAGGCA-CCGTGCCAACTGAGGGATACAGGGGGAGTGTCGGTCTACCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | 294 ± 133 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0742 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL23 | TAGCTCACTCATTAGGCA-CCTCACAGCCCTTCTTCCCGTATTTGTAGACTAGTTACATT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0743 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL48 | TAGCTCACTCATTAGGCA-CCACACTGTCTTGATTTTGGATTTGTCGGTGCTGACCTGTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0744 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL9 | TAGCTCACTCATTAGGCA-CTGCGAGTGAACTCCTCCTTTTGTATTTAGTGTGCGGATCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0745 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL29 | TAGCTCACTCATTAGGCA-CATGTGGAGTGCGAACTGTCTGGTCTTATCGGGCTCGCTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | N/A | 10 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0795 | 26334590 | 2016 | Label-free and highly sensitive electrochemical detection of E. coli based on rolling circle amplifications coupled peroxidase-mimicking DNAzyme amplification | Anti-E. coli aptamer | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Whole cell | Label-free electrochemical biosensor using RCA coupled DNAzyme amplification for detecting E. coli. | Exhibits detection limits of 8 cfu/mL and a detection range of 5 orders of magnitude. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0813 | 27427591 | 2016 | Duplex Identification of Staphylococcus aureus by Aptamer and Gold Nanoparticles | SA23 | GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Develop an aptamer-AuNPs-based colorimetric method for duplex identification of S. aureus. | AuNPs as a sensor could well distinguish S. aureus from S. enteritidis and P. mirabilis. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0824 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-GGCCAGCAGCGAGTGTGGAGTATTGTGTTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 50 ± 2 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0825 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGGCAGGTGTTATGTGTACTGCTACAGTGTGGTTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 54 ± 2 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0826 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-GGCACGGCATGTGTGGTATGTGGTGCCTGTACTCG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | N/A | 14 | Fluorescence Spectroscopy | 53 ± 5 nM | Therapeutics | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0834 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08 | ATGAGAGCGTCGGTGTGGTAACTTAATCCTCTAGTTTTAATTCTAGATACGGCGCATGCACTCTATGTAGGAGGGTGCGGAAGTA | 85 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 54.9 ± 7.8 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0835 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27 | ATGAGAGCGTCGGTGTGGTAACTAGTCTGATTTCTATTTCCTTTAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 86 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 28.5 ± 4.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0836 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN27.SH | TAATTAGTCTGCACACATTGCATTGTAGGAGGGTGCGGAAGTA | 43 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 26.9 ± 5.6 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0837 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN08.SH | ATGCACTCTATGTAGGAGGGTGCGGA | 26 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 52.9 ± 10.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0838 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN17.SH | ATCCTCCTATCTATCGGTAGTTGTAGGAGGGTGCGG | 36 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 29 ± 7.3 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0839 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | JN21.SH | AGAGCGTCGGTGTGGTAACTGTTCAGGAGGATGACATTGTCGCCT | 45 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 18.1 ± 3.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0840 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St17Lp21 | ATCCTCCTAGGTAACTGTTCAGGATGTAGGAGGGT | 35 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 16.9 ± 3.9 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0841 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 13.5 ± 2 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0842 | 28937998 | 2017 | Selection of DNA aptamers specific for live Pseudomonas aeruginosa | St08Lp17 | ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG | 32 | 5'-ATGAGAGCGTCGGTGTGGTA-N45-TACTTCCGCACCCTCCTACA-3' | ssDNA | Pseudomonas Aeruginosa 692 (PA692) (ATCC 14502) | Whole live and biofilm derived PA692 P. aeruginosa cells | Identify aptamers to P. aeruginosa grown as biofilms in microfluidic cells. | All aptamers were selective for P. aeruginosa with minimal cross-reactivity. | 7 | Flow Cytometry | 12.5 ± 2.4 nM | Detection | Whole Cell-SELEX | N/A | Aptamers had no intrinsic bacteriostatic and/or bactericidal activity. | N/A | N/A | N/A | N/A |
| ABdb_0918 | 28119514 | 2017 | High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii | Peptidoglycan | Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting. | Antibac1 bound with higher efficiency to both gram-positive (S. aureus, S. penumoniae, L. monocytogenes) and gram-negative (A. baumannii, C. freudii, K. pneumoniae, P. aeruginosa, P. mirabilis). | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 268.50 ± 54.34 nM (for A. baumannii); 51.74 ± 11.75 nM (for L. monocytogenes); 31.82 ± 4.38 nM (for E.coli); 170.10 ± 32.13 nM (for S.aureus) and 256.10 ± 47.89 nM (for K. pneumoniae) | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0919 | 28119514 | 2017 | High Efficiency Binding Aptamers for a Wide Range of Bacterial Sepsis Agents | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922), Klebsiella Pneumoniae (ATCC 27853), Proteus Mirabilis (ATCC 00557), Pseudomonas Aeruginosa (ATCC 700603), Staphylococcus aureus (S. aureus) (ATCC 29213), Streptococcus Pneumoniae (ATCC 23855), and Enterococcus Faecium (ATCC 29212), and Proteus Vulgaris, Morganella Morganii, Citrobacter Freundii, and Acinetobacter Baumannii | Peptidoglycan | Develop generic probes as biological recognition elements in biosensors for sepsis diagnosis in the clinical setting. | Antibac2 bound with higher efficiency to the gram-positive species S. aureus and E. faecium and to the gram-negative species (A. baumannii, C. freudii, K. pneumoniae, M. moraganii, P. aeruginosa, P. mirabilis, and E. coli). | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 71.92 ± 9.74 nM (for A. baumannii); 54.19 ± 12.09 nM (for L. monocytogenes); 62.43 ± 11.97 nM (for E.coli); 194.90 ± 38.55 nM (for S.aureus) and 195.90 ± 42.91 nM (for K. pneumoniae) | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0958 | 28107686 | 2017 | A novel aptasensor for the colorimetric detection of S. typhimurium based on gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Colorimetric aptasensor was developed based on color changing GNPs for the detection of S. typhimurium. | Quantitative detection of S. typhimurium from 10(2) to 10(7) cfu/mL with a detection limit as low as 56 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0960 | 29030671 | 2017 | Graphene-based label-free electrochemical aptasensor for rapid and sensitive detection of foodborne pathogen | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | rGO-azophloxine (AP) nanocomposite aptasensor was developed for the detection of foodborne pathogens. | Exhibited a linear range of detection from 10(8) to 10(1) cfu/mL with a detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Aptasensor showed good stability for up to 20 days, with a 5.1% increase in current response when stored in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_0961 | 28645756 | 2017 | An aptamer-based PCR method coupled with magnetic immunoseparation for sensitive detection of Salmonella Typhimurium in ground turkey | S. Typhimurium aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based PCR method coupled with magnetic immunoseparation was developed to detect S. Typhimurium from ground turkey. | Able to detect 10(2) CFU/mL of S. Typhimurium in pure culture, and 10(3) CFU/mL of S. Typhimurium in ground turkey. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0967 | https://doi.org/10.1016/j.snb.2017.07.074 | 2017 | A point-of-need enzyme linked aptamer assay for Mycobacterium tuberculosis detection using a smartphone | Indirect Dot-Blot Aptamer | GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-GGCGCCATAGCGACGGGGCCATTCCAAGAA-GGGTCAATGCGTCATA | 88 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Ra) | Mannose-capped lipoarabinomannan (ManLAM) epitope | Smartphone-based method using enzyme-linked aptamers for point-of-need M.tb detection. | The limit of quantitation (LOQ) for indirect assays was 10(5) CFU/mL. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0968 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA1 | TCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCT | 57 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0969 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 2 | TCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCT | 61 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0970 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 3 | TCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCT | 65 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | The sensor has a linear calibration range of 1-150 ng/mL and a detection limit of 50 pg/mL, quantitatively, with the portable spectrophotometer, and 20 ng/mL, semi-quantitatively, with the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0971 | 27816585 | 2017 | A rapid and visual aptasensor for Lipopolysaccharides detection based on the bulb-like triplex turn-on switch coupled with HCR-HRP nanostructures | BLA 4 | TCTCTCTCTCCCTTTAGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCTTTTCCCTCTCTCTCT | 69 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Lipopolysaccharide (LPS) | Developed a turn-on sensor based on a bulb-like triplex turn-on switch (BTTS) for the detection of lipopolysaccharides. | N/A | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0981 | 28159108 | 2017 | An enhanced chemiluminescence resonance energy transfer aptasensor based on rolling circle amplification and WS2 nanosheet for Staphylococcus aureus detection | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | A chemiluminescence resonance energy transfer aptasensor was developed for the detection of S. aureus with Co2+ enhanced N-(aminobutyl)-N-(ethylisoluminol) (ABEI) functional flowerlike gold nanoparticles (Co2+/ABEI-AuNFs) and WS2 nanosheet. | The CL signal was found to be linear within the range of 50 cfu/mL to 1.5 × 10(5) cfu/mL, and the limit of detection was 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_0999 | https://doi.org/10.1007/s00604-017-2383-0 | 2017 | Rolling circle amplification based amperometric aptamer/immuno hybrid biosensor for ultrasensitive detection of Vibrio parahaemolyticus | Vp-aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an antibody-aptamer-based hetero-sandwich amperometric biosensor for the detection of V. parahaemolyticus. | Achieved a range of 2.2 to 2.2 x10(8) cfu/mL, and the limit of detection is as low as 2 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After 2 weeks of storage at 4°C, the fabricated electrochemical aptasensor retains about 95.2% of its initial sensing current response. | N/A | N/A | N/A |
| ABdb_1068 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S2 | CAGTCCAGGACAGATTCGCGAG-GCGGGAATAGGATGCGGCTGGAAGGAGAGGTGTTGGTGGGTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1069 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S3 | CAGTCCAGGACAGATTCGCGAG-GTGCGGTGACGTGAGGGGGAGAGGCGTTGGTGTAGGCTGTTGGTG-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | N/A | 19 | Quartz Crystal Microbalance (QCM) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1074 | 30247907 | 2018 | Graphene Oxide Quantum Dots Assisted Construction of Fluorescent Aptasensor for Rapid Detection of Pseudomonas aeruginosa in Food Samples | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Develop a fluorescent aptasensor based on DNA hybridization and fluorescence resonance energy transfer for the detection of P. aeruginosa. | Shows a wide linear range of 1.28 × 10(3)-2.00 × 10(7) cfu/mL with a detection limit of 100 cfu/mL within 2 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1075 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA1 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGCTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | Achieved a wide detection range from 10(1) to 10(7) CFU/mL with a detection limit as low as 9 CFU/mL. | 12 | N/A | 15.16 ± 3.62 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1076 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA2 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGTGACCGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 14.11 ± 2.59 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1077 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA3 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACACGACGCATGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 84 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 32.59 ± 8.89 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1078 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA4 | TGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGACGCACGTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 82 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 16.39 ± 8.14 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1079 | 35547676 | 2018 | Development of a fluorescence assay for highly sensitive detection of Pseudomonas aeruginosa based on an aptamer-carbon dots/graphene oxide system | PA5 | TGGACCTTGCGATTGACAGCTCGTGGCACGTGCCGCTCGCCTTGGACCTTGCGATTGACAGCAGACATGAGTCTCAGGAC | 80 | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Identify and develop an aptamer-based fluorescence assay (aptamer-CDs/GO system) for culture-independent detection of P. aeruginosa. | N/A | 12 | N/A | 30.69 ± 7.15 nM | Biosensor | Whole Cell-SELEX with the High-Throughput Sequencing (HTS) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1108 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt1 | AGGGTTGGTCGTCCAGCATTCCGTTCGATTGTAGTTCTGACTCTTGTGAAGTTAATGAGCTCCTTTTGCTGACTGTTGTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1109 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt2 | TTCTGATGAGAGTTGCGACCTCCCGGATGAGTGCCCTGGCTCCGGGTTTGTCTATTTTTGGGGGTGTTGACAGATATCCT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | Vapt2 could detect the pathogen in a wide concentration range: 8–2.0 × 10^8 cfu/ml.The Limit of Detection (LOD) was 8 cfu/ml. | 13 | Fluorescence Microscopy | 26.8 ± 5.3 nM | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1110 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt3 | ATCGGATATGAGGCCGGGTATTAAGTGGGGTTCCATATGCAAGGCAGATCTCCCAGTGTTTTTTCAGGATTGCGTTACTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1111 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt4 | AAGAGGGCTTGGGAACTCTAGGCGTCTGTGCATTAAGCCATGTCTGCCGGGAAAGATCTGTGAAGTGTTCGCCCGCACTT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1112 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt5 | GCATGGGTATAGGGAAACCCGAGTCTAGTTTACACTGACGTTAGGAGATTACGTCTGCCGACAGAACATTCTCTCTGTGA | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1113 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt6 | GGCGGGGTGTTATGAATCCACCGCGATCCGTTATGTTAGGCTGTAATCATTAAGCACTTTATGTGCACTCGTGGTATGCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1114 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt7 | AATTACTGGAGCTTGGCCGTAGGTAGAAAGATTTGCATTATACCTGGGGGGCTCTCTGGTTGTGTTTAATTGGTTACCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1115 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt8 | ATGCTGCACTAGTTACCTTGCCTTTGCTTTCTTATTCTGCTCGTGCGTAAAAGTGGTTTTTCTTGCGTTGCGGGTGCTTG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1116 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt9 | TGTTCGTTCGACTTCTCCGTCGTTTTTGTATTAACGTAGACCTTGGTTGAGCATGCTTACCTCTGCTTGGATTAATGACG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1117 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt10 | TAAGGATCTTGGGTTCATGCCGCAACTGGGATGTTTGCTGCCTCCTTTATGGAGCTTAGCTGCGAGCGTTCTTGTTTGGT | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1118 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt11 | GTCTAAGTGCTTCTAGGCGGATTTGGCGCGTTCCGACGATTAGACTAGGACAACGATTCAGTGGTGTCGATGGTGTGTTC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1119 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt12 | GGGGTAAGCCCGCGGCTCTCTCCTATGTATTCAGTGTACTCACGAAGATGTCCGTACTCCGTACGCTGCTATGCGTTCCC | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1120 | 30270541 | 2018 | Identification of a highly specific DNA aptamer for Vibrio vulnificus using systematic evolution of ligands by exponential enrichment coupled with asymmetric PCR | Vapt13 | TCGGGGGCGCAGCTTGGGCCGTTGCTCCTGCCGGTCTCTGTGTGCGTGCGGTTCTCGCTCTTGTGGCTCCGTCCTTGGGG | 80 | 5'-GGCGAAACATCTT-N80-TAGTGACGGTAAGCTTGGCAC-3' | ssDNA | Vibrio Vulnificus | Whole cell | Identify an aptamer for the detection of V. vulnificus. | N/A | 13 | Fluorescence Microscopy | N/A | Detection | SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1121 | 30187142 | 2018 | Colorimetric aptasensor for Campylobacter jejuni cells by exploiting the peroxidase like activity of Au@Pd nanoparticles | aptamer | GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT | 81 | N/A | ssDNA | Campylobacter Jejuni | Surface protein | Develop a colorimetric aptasensor based on an aptamer and Au@Pd NPs peroxidase for the determination of C. jejuni in the milk sample. | The Limit of Detection (LOD) achieved was 10 CFU/mL in phosphate-buffered saline and 100 CFU/mL in milk samples with a linear range from 10 to 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1150 | 29550346 | 2018 | An aptasensor for staphylococcus aureus based on nicking enzyme amplification reaction and rolling circle amplification | Aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A chemiluminescence aptasensor for S. aureus detection based on aptamer recognition and the DNA amplification cycle (NEAR-RCA) was developed. | Detect S. aureus specifically with a good linear correlation at 5-10(4) CFU/mL and limit of detection (LoD) of 5 CFU/mL. | N/A | N/A | 210.70 ± 135.91 nM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1153 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#2 | ATACCAGCTTATTCAATT-CCACGTTTCCACGTATCCTCGGAGCTTGCTTAACCGTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1154 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#3 | ATACCAGCTTATTCAATT-TGCGTAGTTCTTTTAACAACCATTCAGCGTATTTTCGTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1155 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#4 | ATACCAGCTTATTCAATT-CCCTCGGCGTAACTAGTACCGTTGCACCACCAACGTGATT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1156 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#5 | ATACCAGCTTATTCAATT-CGCAAGGGATTTCGGACCGGGCTTGGTCACACACAGAGCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1157 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#6 | ATACCAGCTTATTCAATT-CCAGCAGTGGGGCATGGGGGAACGATAAGATTATAAGGGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1158 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#7 | ATACCAGCTTATTCAATT-CACGCAAGCAGAAGCCACTCCCCCTGGTCGTACTATTTAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1159 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#8 | ATACCAGCTTATTCAATT-CACAGGCGTACCACTGCCCCAACGATCCTTTTGGTTACCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1160 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#9 | ATACCAGCTTATTCAATT-GTCGGAGAGCCTGGCCGTCTGCTCGTAAGTACTATCATAGC-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1161 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#10 | ATACCAGCTTATTCAATT-TGGAGAAGCGGCAGTTGATGCCTGGTACCCGTCTGCTACG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1162 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#11 | ATACCAGCTTATTCAATT-CGTAAAGGACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1163 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#12 | ATACCAGCTTATTCAATT-CGTAAAGAACGCTGCCATGAATGTGCTATCCAAGCCTGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1164 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#13 | ATACCAGCTTATTCAATT-CGTAAGAACGCTGCCATGAATGTGCTATCCAGGCCTGGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1165 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#14 | ATACCAGCTTATTCAATT-CAACGGAGGGAAGTTTCCATGTCCGGTACCAAGCGGTTTTTG-AGATAGTAAGTGCAATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1166 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#15 | ATACCAGCTTATTCAATT-GCACGGGAGGCACCCTGACATTGCAAATCCCATCGGTGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1167 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#16 | ATACCAGCTTATTCAATT-ACCTATAACAGCCATCATACGAGGTAATCCCCTCCCTCGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1168 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#17 | ATACCAGCTTATTCAATT-CCAACTGGATCTTACTGAGGAACGGTCCATTAGCACATCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1169 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#18 | ATACCAGCTTATTCAATT-CGCGACCACATCCTGCGTAAACACATCTCCGCCAGTCCAT-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1170 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#19 | ATACCAGCTTATTCAATT-CGCAAGAGCAGCATACAGCACGAACGAGCCATTTACGCCA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1171 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#20 | ATACCAGCTTATTCAATT-CGAAGACCAGACATGGTAGCCACGCATAGTCCAACTTAAG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1172 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#21 | ATACCAGCTTATTCAATT-ACACCACACTAATGCATGCATTCTGTGAGTCACAGTTCA-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1173 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#22 | ATACCAGCTTATTCAATT-CACTCAAACCCAAACCATGCAAACTGAACAACGCAACACA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1174 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#23 | ATACCAGCTTATTCAATT-CACCAAACTGCCCAAATTTGAGGACGCCCTATACATGCG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1175 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#24 | ATACCAGCTTATTCAATT-GCCCAATACGTATGTTGATACATGCCCCTTACCCTTTGCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1176 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#25 | ATACCAGCTTATTCAATT-CACCGTAGTAAGTAAGCAGACGCTAAGGATGTTGCCAGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1177 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#26 | ATACCAGCTTATTCAATT-GTGACATGAACTGGTTTTCCACAGCTTAGGATCATGGATG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1178 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#27 | ATACCAGCTTATTCAATT-GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1179 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#28 | ATACCAGCTTATTCAATT-CCGTCGCTATAACCCTGTCTTTATATATCTTCGCCCACGGG-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | N/A | 11 | Surface Plasmon Resonance (SPR) | N/A | Diagnostic | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1183 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C5 | CCTAACCGATATCACACTCAC-GGCTAGCGGACAGGTGTAGGTCGGAATCCTTCAGCGTAGA-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1184 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C7 | CCTAACCGATATCACACTCAC-AGTATACCGCTCCACCAGTGTGATATCGGGATCTGCTGAC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1185 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C10 | CCTAACCGATATCACACTCAC-GTAGTGAGGTGGGTCGTGAAGGGAGGCACTACTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1186 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C13 | CCTAACCGATATCACACTCAC-GAGGTGAGGGTGCGAGGGTAAGGGGGCAAACCTGGTGCGT-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1187 | 30236483 | 2018 | Staggered Target SELEX, a novel approach to isolate non-cross-reactive aptamer for detection of SEA by apta-qPCR | C16 | CCTAACCGATATCACACTCAC-ACGTAGTGAGGGTTGCGAGGGTAAGGTGGTCAGTATACGC-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-40N-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers by ST-SELEX and use them for the detection of SEA via apta-Real-time PCR (apta-qPCR). | The limit of detection (LOD) was 146.67 fM. | 10 | Surface Plasmon Resonance (SPR) | 7.44 ± 0.6 nM | Detection | Staggered Target SELEX (ST-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1193 | 29907294 | 2018 | New colorimetric aptasensor for rapid on-site detection of Campylobacter jejuni and Campylobacter coli in chicken carcass samples | ONS-23TA | ACAAGGGACAGTAGACCAACAGGAAATCAAAGGCCGTGGGAA | 42 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33560, NCTC11168, 2 human isolates, and 3 food isolates) | Whole cell | A 2-stage label-free aptasensing platform was developed to detect C. jejuni and C. coli. | Detection limit (LOD) of 7.2×10^5 CFU/mL and linear range from 10(5) to 10(8) CFU/mL for C. jejuni. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1194 | 29907294 | 2018 | New colorimetric aptasensor for rapid on-site detection of Campylobacter jejuni and Campylobacter coli in chicken carcass samples | ONS-23TA | ACAAGGGACAGTAGACCAACAGGAAATCAAAGGCCGTGGGAA | 42 | N/A | ssDNA | Campylobacter Coli (ATCC 33559 and 3 food isolates) | Whole cell | Aptamers normally adsorb to gold nanoparticles (AuNPs) to protect them from salt-induced aggregation. | Detection limit (LOD) of 5.6×10^5 CFU/mL with a strong correlation (from 10(5) to 10(8) CFU/mL) for C. coli. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1196 | 30081031 | 2018 | Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium | S. typhimurium binding Aptamer (Apt1) | CCAAAGGCTACGCGTTAACGTGGTGTTGG | 29 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A label-free fluorescent aptasensor was developed for the detection of Salmonella typhimurium using SYBR Green I. | Achieved a linear range of approximately 1530-96938 CFU/mL and a detection limit of 733 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1197 | 30081031 | 2018 | Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium | S. typhimurium binding Aptamer (Apt2) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | An aptasensor based on FRET between Rhodamine B and gold nanoparticles for the detection of Salmonella typhimurium was developed. | Achieved concentrations ranging from 1530 to 96938 CFU/mL, with a detection limit of 464 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1220 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A16 | CCATCCACACTCCGCAAGTGGGGAGGGGAGAGACGACGATCCTGTGGGTTTTCTGCAGTGAGTCGTGTTTTCGACTTATTGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | 28.47 nM | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1221 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A46 | CCATCCACACTCCGCAAGTATGAGGACAGTTGGAGGGCGCGCCGTGTTTTTTCTGCAGTGAGTCGTGTTTCCTCGCTCACGCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1222 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A1 | CCATCCACACTCCGCAAGTTTTAGGAGTAGTGGTGTGGGGACCGACTCTTTTCTGCAGTGAGTCGTGTTTTCGAGTCATCCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1223 | 30779754 | 2019 | C4-HSL aptamers for blocking quorum sensing and inhibiting biofilm formation in Pseudomonas aeruginosa and its structure prediction and analysis | A2 | CCATCCACACTCCGCAAGTGAGATGTGGTGTAGGCAACTCGGCATAGATTTTCTGCAGTGAGTCGTGTTTTTTGACACGGCCGTCGGCTGCCTCTACAT | 99 | 5'-CCATCCACACTCCGCAAG-N30-TTTT-hybridsequence-TTTT-N10-CGTCGGCTGCCTCTACAT-3' | ssDNA | Pseudomonas Aeruginosa | C4-HSL of the rhl system quorum sensing molecule | Identify aptamers that inhibit biofilm formation and quorum sensing. | Biofilm formation by P. aeruginosa was reduced by about 1/3. | 10 | Saturation Binding Assay | N/A | Therapeutics | Structure Switching SELEX | N/A | Aptamers caused no effect on bacterial growth. | N/A | N/A | N/A | N/A |
| ABdb_1224 | 30637436 | 2019 | Aptamer-mediated colorimetric and electrochemical detection of Pseudomonas aeruginosa utilizing peroxidase-mimic activity of gold NanoZyme | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-mediated tunable NanoZyme colorimetric and electrochemical sensors for the detection of Pseudomonas aeruginosa. | Possess a detection limit of the electrochemical sensor of ~ 60 CFU/mL in water within 10 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1229 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | E. coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours, and the MIC for E. coli was approximately 0.1 and 1 μg/mL for gentamicin and amikacin, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1231 | 31472413 | 2019 | Vertical capacitance aptasensors for real-time monitoring of bacterial growth and antibiotic susceptibility in blood | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Vertical-type aptamer-functionalized sensor (aptasensor) for monitoring bacterial growth and antibiotic susceptibility in blood in real-time. | Detect bacteria growth in blood at 10(0)-10(3) CFU/mL in real-time within 12 hours and the MIC for P. aeruginosa was approximately 1 μg/mL for both gentamicin and amikacin. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1245 | 30825657 | 2019 | A reduced graphene oxide-titanium dioxide nanocomposite based electrochemical aptasensor for rapid and sensitive detection of Salmonella enterica | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a rGO-TiO2 electrochemical aptasensor for the detection of Salmonella bacteria. | Exhibited high sensitivity with a wide detection range (10(8) to 10(1) cfu/mL), a low detection limit of 10(1) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | Showed good durability up to 21 days with a 10% decrease in signal after 30 days of non-use. | N/A | N/A | N/A |
| ABdb_1246 | https://doi.org/10.1016/j.foodcont.2019.106806 | 2019 | A competitive enzyme linked aptasensor with rolling circle amplification (ELARCA) assay for colorimetric detection of Listeria monocytogenes | Aptamer | TATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 48 | N/A | ssDNA | Listeria Monocytogenes (CMCC 54007) | Whole cell | Developed an enzyme-linked aptasensor with rolling circle amplification (ELARCA) assay for the detection of L. monocytogenes. | Showed a limit of detection (LOD) of 4.6 × 10(2) CFU/mL in pure culture, and in fresh lettuce showed an LOD of 6.1 × 10(3) CFU/g. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1274 | 30637507 | 2019 | Colorimetric detection and typing of E. coli lipopolysaccharides based on a dual aptamer-functionalized gold nanoparticle probe | Specific aptamer (S-probe) | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Develop a dual aptamer-based colorimetric method for the identification of E.coli LPS. | Can detect LPS in concentrations between 2.5 and 20 μg/mL and with a 1 μg/mL detection limit. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1275 | 30637507 | 2019 | Colorimetric detection and typing of E. coli lipopolysaccharides based on a dual aptamer-functionalized gold nanoparticle probe | General aptamer (G-probe) | AGCAATTGGTCCTCGCTTAGCTTCTACGGTGGGCTATCT | 39 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 and O111:B5 | Ethanolamine | Develop a dual aptamer-based colorimetric method for the identification of E.coli LPS. | Can detect LPS in concentrations between 2.5 and 20 μg/mL and with a 1 μg/mL detection limit. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1278 | 31380872 | 2019 | A transcription aptasensor: amplified, label-free and culture-independent detection of foodborne pathogens via light-up RNA aptamers | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Develop a transcription aptasensor by using a light-up RNA aptamer for culture-free detection of intact foodborne pathogens. | The dynamic range was 10(2)-10(6) CFU/mL, and the LOD of the transcription aptasensor was estimated to be 77.0 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1321 | 31563315 | 2019 | Rapid identification and quantitation of the viable cells of Lactobacillus casei in fermented dairy products using an aptamer-based strategy powered by a novel cell-SELEX protocol | Apt-1 | ATCGTATACCTAGAAGATATGACCGGCAGTTGATGAGATAGAGGCGCTGGTGGGTAGATA | 60 | 5'-TCAGCACGT-N60-TCCACTGAGAGATCC-3' | ssDNA | Lactobacillus Casei (ATCC 393) | Whole cell | An aptamer-based strategy using PEG and chitosan-modified graphene oxide, with complementary ring-mediated RCA, was developed for qualitative and quantitative detection of viable L. casei in dairy products. | N/A | 8 | Flow Cytometry | 21.1 ± 2.7 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1338 | 30622036 | 2019 | An electrochemical aptasensor for staphylococcal enterotoxin B detection based on reduced graphene oxide and gold nano-urchins | Aptamer SEB | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | An electrochemical aptasensor was developed using a screen-printed electrode modified with reduced graphene oxide (rGO) and gold nano-urchins (AuNUs) for the detection of SEB. | A wide linear range of 5.0–500.0 fM was observed, with a detection limit of 0.21 fM. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1346 | https://doi.org/10.1016/j.foodcont.2018.11.048 | 2019 | Naked-eyes detection of Shigella flexneri in food samples based on a novel gold nanoparticle-based colorimetric aptasensor | Sh. flexneri binding aptamer | CCGGACTAGGGCTGGTTAGCTTCAATACTGCTGGGCGAGG | 40 | N/A | ssDNA | Shigella Flexneri (ATCC 12022) | Whole cell | Developed a colourimetric aptasensor based on an aptamer and gold nanoparticles (AuNPs) for the visual detection of Sh. flexneri. | Achieved a linear range from 10(2) to 10(6) CFU/mL with the detection limit of 80 CFU/mL, and the detection time was 20 min or less. | 14 | N/A | 42.6 ± 7.11 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1347 | 31196418 | 2019 | Functional chimera aptamer and molecular beacon based fluorescent detection of Staphylococcus aureus with strand displacement-target recycling amplification | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a fluorescent detection of S. aureus based on a functional chimaera and a molecular beacon. | Display a broad concentration range from 80 CFU/mL to 8 × 10(6) CFU/mL and the detection limit of 39 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1351 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 5 | CCGGAATTCCTAATACGACTCTACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | Exhibited the highest biofilm inhibition towards EPEC K1.1 shown by lowest OD value of 0.126. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1352 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 1 | CCGGAATTCCTAATACGACTCTGCGGACTGTATGCGGTACGGTCGAAAATAGTGAAGGTGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1353 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 4 | CCGGAATTCCTAATACGACTCACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1354 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 8 colony 7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1355 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 9 colony 3 | CCGGAATTCCTAATACGACTCGAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1356 | 32981012 | 2020 | Inhibition of enteropathogenic Escherichia coli biofilm formation by DNA aptamer | SELEX 10 colony 10 | CCGGAATTCCTAATACGACTCATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Interfering with the biofilm formation via abolishing the motility and quorum sensing. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1369 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (U433, U556-ESBL, B12327, U5307, U6267-ESBL) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1370 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 2 | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii (P762, T800, R4197, R4299, R4356) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1371 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 3 | N/A | N/A | 5'-GCAATGGTACGGTACTTCC-(N45)-CAAAAGTGCACGCTACTTTGCTAA-3' | ssDNA | Klebsiella Pneumoniae (PAE1, PAE2, PAE3, PAE4, PAE5) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1373 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 5 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (P101, T82, C970, R4308, R4319) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1374 | 32792573 | 2020 | Electrical antimicrobial susceptibility testing based on aptamer-functionalized capacitance sensor array for clinical isolates | Aptamer 6 | ATCCAGAGTGACGCAGCACGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTGTGGACACGGTGGCTTA | 70 | N/A | ssDNA | Enterococcus Faecalis (R1238, U554, U5179, U4879, U5064) | Whole cell | Electrical AST (e-AST) chips composed of 60 aptamer-functionalized capacitance sensors to detect bacteria and measure the antibiotic susceptibility to 11 antibiotics at five different concentrations. | The discrepancies between e-AST and BMD tests were estimated to be 2.20% mE, 0.38% ME, and 0.38%, which are lower than the FDA requirements (mE ≤ 10%, ME ≤ 3%, and VME ≤ 1.5%). | N/A | N/A | N/A | Diagnostic | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1375 | 32451800 | 2020 | Inhibition of Salmonella enteritidis biofilms by Salmonella invasion protein-targeting aptamer | Apt17 | TAGGGAAGAGAAGGACATATGAT-GCAATGGAACCGCTGAACGACCCTAGCATTATCAGTGTGG-TTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Enteritidis (S. Enteritidis) TM 6 andTM 68 | Salmonella invasion proteinA (SipA) | An aptamer targets the SipA protein to inhibit Salmonella biofilm formation by interfering with the T3SS. | Co-incubation of Apt17 with ampicillin MIC/10 for 24 h inhibited the biofilms of S. enteritidis TM 6 and S. enteritidis TM 68 by 12.5% and 20.9% respectively. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1376 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC1 | TACTTCCGCACCCTCCTACA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1377 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC2 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1378 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC3 | CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA | 49 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1379 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC5 | ATGAGAGCGTCGGTGTGGTA-CCCTTTCCCTTTCCCATTCCCGTTCCCTTTCCCTTTCCCATTCCCGTTA-TACTTCCGCACCCTCCTACA | 89 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1380 | 32785202 | 2020 | Spectroscopic Study on Pseudomonas Aeruginosa Biofilm in the Presence of the Aptamer-DNA Scaffolded Silver Nanoclusters | NC6 | ATGAGAGCGTCGGTGTGGTA | 20 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Biofilm | DNA aptamer-enclosed silver nanoclusters (Ag-NC) were used to prevent biofilms. | Potency of an aptamer-DNA enclosed Ag-NC with a decrease in the net Ld wrt control follows NC2 > NC1 > NC5 > positive control ≈ NC3 > NC6. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1386 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF501 | TAGGGAAGAGAAGGACATATGAT-TTTCTCAACGGGACCATCACTTACCTCAAGTACTTGGACG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1387 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF502 | TAGGGAAGAGAAGGACATATGAT-CCGGCTATCTCCCTACCGTGGCCGAGTACCTCAAACGTTT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1388 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF503 | TAGGGAAGAGAAGGACATATGAT-GTCAACTCATTTATGGTGCTCCTCGTACCTCAGGTGGTTA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1389 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF504 | TAGGGAAGAGAAGGACATATGAT-GGCCATACCTCGTGCCTTCTGTGATCATCTCTATCAATTG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1390 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF505 | TAGGGAAGAGAAGGACATATGAT-CCTCTCTCTTACTGCTACTGGGCAGGGTACTCAATTACGT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1391 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF506 | TAGGGAAGAGAAGGACATATGAT-CGGTCCCGACTCAATATTGTTCCCTCCCCTTATCAGGCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1392 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF507 | TAGGGAAGAGAAGGACATATGAT-TCCTCTAATCAACTCTATGCCTTATCCCCTTGGTCAGGAC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1394 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF509 | TAGGGAAGAGAAGGACATATGAT-CCTCACTCTTGACCCAAAGTGCATGCTCTATTCATTCGGA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1395 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF510 | TAGGGAAGAGAAGGACATATGAT-GCTTCTGTGCACATTAAGGCACTCGTCTTCACTGTGGTTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1396 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF511 | TAGGGAAGAGAAGGACATATGAT-CCTAACTCACTTACCAGCACGAGGTGCCTGTACCATCAAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1397 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF512 | TAGGGAAGAGAAGGACATATGAT-CTCTCATCACAGGAATTTGAATTTCCCTTGTGGACAGTAA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1398 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF513 | TAGGGAAGAGAAGGACATATGAT-GATGTGAATTCCGTCCCTTGGTCAGACACTTCAACACCGG-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1399 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF514 | TAGGGAAGAGAAGGACATATGAT-TCTCGACGCTATGATCAAGACGCAGTATGATGGCACATCA-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1400 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF515 | TAGGGAAGAGAAGGACATATGAT-TTAACCCTCATTTAATGGCCGCGTCAATCCGCAAAGGGTC-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1401 | 33262379 | 2020 | DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing | EF516 | TAGGGAAGAGAAGGACATATGAT-TTCCTTCGCAGGACACCGATGGCCAGGCGCGAGTCAATAT-TTGACTAGTACATGACCACTTGA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Enterococcus faecalis (E. faecalis) DSM-20478 | Whole cell | Identify aptamers against E.faecalis and can discriminate them from other species. | N/A | 11 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1402 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-1 | AAAAAAAAAAAAAAAAAAAACCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 62 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1405 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 1 | ATTAGTCAAGAGGTAGACGCACATAAGGGGTCTGGTGTCGGGCCGCGGGTCAGGGGGGTAAGGGATTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10 CFU/mL within 15 min with no cross-reactivity with other bacterial species. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1406 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 2 | ATTAGTCAAGAGGTAGACGCACATAAGGAGTCACGACGACCAGAAACGTTTGCGGTGTTGAGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | The detection limit was 10(3) CFU/mL. | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1407 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 3 | ATTAGTCAAGAGGTAGACGCACATAACGGCGGCAGCGAGGGCGAACCAGGGGGGGCACACCGAGCTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1408 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 4 | ATTAGTCAAGAGGTAGACGCACATAAGTATTTAGCGAACTCGCGGAGGTTCAGTAAAGAATGTACTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1409 | 32810775 | 2020 | Highly adaptable and sensitive FRET-based aptamer assay for the detection of Salmonella paratyphi A | Sal 5 | ATTAGTCAAGAGGTAGACGCACATAGCCACTCGACCCGCCAGAAACGGCGACAGGATGGCCGCGGTTCTGGTCGTCGTGACTCCTAT | 87 | 5'-ATAGGAGTCACGACGACCAGAA-40N-TATGTGCGTCTACCTCTTGACTAAT-3' | ssDNA | Salmonella Paratyphi A (ATCC 9150) | Whole cell | Identify an aptamer and develop a GO/CdTeQDaptamer-based FRET assay for the detection of Salmonella paratyphi A. | N/A | 11 | Indirect ELASA (aptamer linked immunosorbent assay) | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1410 | https://doi.org/10.1007/s12161-020-01821-4 | 2020 | Fluorescent Turn-on Aptasensor of Staphylococcus aureus Based on the FRET Between Green Carbon Quantum Dot and Gold Nanoparticle | Staphylococcus aureus aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed FRET-based aptasensor with CQDs and GNPs for the detection of S. aureus. | Linear detection range of 10⁸ to 10¹ CFU/mL with a detection limit (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1411 | 32892935 | 2020 | Naked-eye based point-of-care detection of E.coli O157: H7 by a signal-amplified microfluidic aptasensor | Anti-E.coli O157: H7 aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (BNCC 191201) | Whole cell | Developed an eye-based aptasensor (EA-Sensor) for the detection of E.coli O157:H7. | Display a linear range of 500–5 × 10(7) CFU/mL and LOD of 250 CFU/mL and 400 CFU/mL for buffered and milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1452 | 32724645 | 2020 | Selection of aptamers targeted to food-borne pathogenic bacteria Vibrio parahaemolyticus | S.184004.T1.09 (ID 15) | GCCCACTGAACTGTGGCGGGCACAGGATGTGGAAGTGGGC | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify high‐affinity aptamers that specifically recognize Vp. | N/A | 2 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | AM X‐aptamer kit | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1470 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.1) | ATCCAGAGTGACGCAGCA-GTAGTTTGTTGGTTATTACGGCGGGTTGCGATGGGTGCGAATCGG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 44.5 pg/mL for stx1 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 8.27 nM (of peptide) and 47.2 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1471 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx1.3) | ATCCAGAGTGACGCAGCA-GGATAGGACGTCAAATTAGGGCCCGGTACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx1 (Stx1.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 31.0 nM (of peptide) and 30.3 μΜ (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1472 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.1) | ATCCAGAGTGACGCAGCA-GGGGGCAGGTTCATGGCTTGGGTGCGGTGGGCATGATTCGTGGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.1) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 45.2 nM (of peptide) and 83.8 nM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1473 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.2) | ATCCAGAGTGACGCAGCA-TGTATCTCTTACTTAAGCCTTTGGTTCGGTAACAGCCTGGCATGC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.2) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | N/A | 7 | Bio-Layer Interferometry (BLI) | 110 nM (of peptide) and 25.2 μM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1474 | 32814208 | 2020 | Biolayer interferometry-SELEX for Shiga toxin antigenic-peptide aptamers & detection via chitosan-WSe2 aptasensor | Apt(Stx2.3) | ATCCAGAGTGACGCAGCA-GGAAAGGACGTCAAATTAGGGGCCGGGACAACGAAAGCCCACAAC-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 str. Sakai | Shiga toxin subtype stx2 (Stx2.3) | Identify anti-Shiga toxin aptamers and develop an Apta/Chito-WSe2 voltammetric detection platform. | LOD of 41.3 pg/mL for stx2 with minimal cross-reactivity and a dynamic response range from 50 pg/mL to 100 ng/mL. | 7 | Bio-Layer Interferometry (BLI) | 4.6 nM (of peptide) and 28.6 pM (of protein) | Detection | Biolayer Interferometry based-SELEX (BLI-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1475 | 32774812 | 2020 | Point-of-care detection of Escherichia coli O157:H7 in water using AuNPs-based aptasensor | Apt 2 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (EHEC) (NTCC 12900) | Whole cell | Developed an aptamer-based AuNPs bioassay to detect EHEC in contaminated water. | Exhibited a good linear response over a wide concentration range of 876 to 107 CFU/mL and a low detection limit (LOD) of 263 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1476 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap1 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 18.10 ± 6.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1477 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap2 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 13.38 ± 3.8 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1478 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap3 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 11.46 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1479 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap4 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 14.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1480 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap5 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 21.78 ± 9.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1482 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap7 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.85 ± 4.1 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1483 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap8 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.90 ± 17.4 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1484 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap9 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 12.18 ± 4.3 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1485 | 31948282 | 2020 | Colorimetric aptasensor for detecting Salmonella spp., Listeria monocytogenes, and Escherichia coli in meat samples | Ap10 | N/A | N/A | 5'-TAGGGAAGAGAAGGACATATGAT-N40-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Listeria Monocytogenes (ATCC 13932), Salmonella spp. (S. typhimurium ATCC 14028, S. anatum DMST 23906, S. albony DMST 24240, S. enteritidis DMST 15676) and Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Identify aptamers against Salmonella spp., Listeria monocytogenes, and Escherichia coli and using gold nanoparticles, develop a colorimetric aptasensor for simultaneous detection. | N/A | 10 | Flow Cytometry | 32.85 ± 12.2 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | Submission Number Petty patent no.: 1803001734 |
| ABdb_1487 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | E. coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCGCAGTTTGGGAAGGGTGATCGCACTATCAGAGGATTCCGTTCGGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC: 21530) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−3) μg/mL tigecycline for 1 h, the Raman peak intensity of E. coli O157: H7 was 882 a.u., and when the concentration of antibiotics was sub-MIC (2(−4) and 2(−5) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 3382 a.u. and 4213 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1488 | 32347530 | 2020 | A sensitive and rapid bacterial antibiotic susceptibility test method by surface enhanced Raman spectroscopy | S. aureus aptamer | TCCCTACGGCGCTAACCTCCCAACCGCTCCACCCTGCCTCCGCCTCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 21600) | Whole cell | Developed a rapid antibiotic susceptibility test (AST) method and determined the MIC value by the Bacteria-aptamer@AgNPs-SERS method. | When treated with 2(−1) μg/mL vancomycin for 1 h, the Raman peak intensity of S. aureus was 556 a.u., and when the concentration of antibiotics was sub-MIC (2(−2) and 2(−3) μg/mL), the peak value of 735 cm−1 increased, and the Raman intensity was 2177 a.u. and 2903 a.u. | N/A | N/A | N/A | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1489 | https://doi.org/10.1016/j.foodcont.2019.106761 | 2020 | Designing an aptamer based magnetic and upconversion nanoparticles conjugated fluorescence sensor for screening Escherichia coli in food | E.coli aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | A novel upconversion fluorescence sensor using magnetic nanoparticles (MNPs) and cDNA-upconversion nanoparticles (UCNPs) for E.coli was developed. | Achieved a lower limit of detection (10 cfu/mL) in the linear range of 58–58 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1490 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M1 | AGCAGCACAGAGGTCAGATGATATAACCTTAATAAATAAAATATAAATTATTTAATCTTACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 37.93 ± 7.88 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1491 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M5 | AGCAGCACAGAGGTCAGATGCTTGGTTCCACCGTACTGACTGTAGTAAAATCTGATCACTCCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 74.96 ± 21.34 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1492 | 35516186 | 2020 | Selection of potential aptamers for specific growth stage detection of Yersinia enterocolitica | M7 | AGCAGCACAGAGGTCAGATGTAGTCGGTCTTCTTGTTTGAAACTGCTAATTTTGAAAAAACCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-40N-TTCACGGTAGCACGCATAGG-3' | ssDNA | Yersinia Enterocolitica (CICC 21669) | Whole cell | Identified aptamers bound to the different growth stages of Y. enterocolitica. | Showed good affinity to all different stages of bacteria (adjustment phase, log phase, and pre-stationary phase). | 10 | Flow Cytometry | 73.02 ± 18.76 nM | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1496 | https://doi.org/10.1016/j.sbsr.2019.100313 | 2020 | Aptamer-NanoZyme mediated sensing platform for the rapid detection of Escherichia coli in fruit juice | Aptamer P12–31(EC 12–31 TRUNC) | CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | An aptamer and NanoZyme-based colorimetric and electrochemical assay was developed for EC detection in fruit juice. | Displayed superior linearity in the range of 10–10(9) CFUs/mL and a low-end detection limit of ~10 CFU within 5 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1498 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt2 | CTCCTCTGACTGTAACCACGGAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCCGCATAGGTAGTCCAGAAGCC | 80 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1503 | 34347427 | 2021 | Aptamer-Functionalized DNA-Silver Nanocluster Nanofilm for Visual Detection and Elimination of Bacteria | Apt-G | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACGGGTGGGGTGGGGTGGGG | 80 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | DNA-templated silver nanoclusters (N4-AgNC/Apt-G) for the visual detection and effective elimination of bacteria. | After treatment with 5 μM N4-AgNCs/Apt-G, a significantly reduced number of colonies was observed. At the lowest inhibitory concentration of 6.25 μM, the number of colonies decreased by only 4-fold, which is significantly less than the 7-fold reduction observed at 5 μM. Obtained recovery rates ranging from 88% to 115% of S. aureus. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | N/A | N4-AgNCs/Apt-G was found to be nontoxic at low concentrations, and cell viability was more than 80% at a concentration of 6.25 μM. | N/A | N/A | N/A | N/A |
| ABdb_1541 | 33285125 | 2021 | An aptamer biosensor based dual signal amplification system for the detection of salmonella typhimurium | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ASI 1174) | Whole cell | Developed a signal-cascade-amplification method named “immuno-HCR-SERS” for the detection of S. typhimurium. | Highly sensitive detection showing a linear range from 10 to 10(5) CFU/mL, with a limit of detection (LOD) of 6 CFU/mL in 3.5 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1543 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Target aptamer (Tapt) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1567 | 33780852 | 2021 | Microfluidic thread-based electrochemical aptasensor for rapid detection of Vibrio parahaemolyticus | Aptamer | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a thread-based microfluidic nano-aptasensor based on MoS2 modified threaded electrodes for V. parahaemolyticus detection. | The proposed aptasensor has a dynamic detection range of 10–10(6) CFU/mL, a detection limit of 5.74 CFU/mL, and an assay time of 30 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1578 | 33836431 | 2021 | Ultra-sensitive photoelectrochemical aptamer biosensor for detecting E. coli O157:H7 based on nonmetallic plasmonic two-dimensional hydrated defective tungsten oxide nanosheets coupling with nitrogen-doped graphene quantum dots (dWO3•H2O@N-GQDs) | E.coli O157:H7 aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a novel PEC aptasensor based on dWO3•H2O@N-GQDs for ultrasensitive detection of E. coli O157:H7. | Achieved a limit of detection of 0.05 CFU/mL and a wide linear detection range from 0.1 to 10(4) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1579 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-V.P | TGGCTAGCTCAGTCATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTCCGCG | 60 | N/A | ssDNA | Vibrio Parahaemolyticus | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 4 CFU/mL for V.P. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1580 | https://doi.org/10.1016/j.snb.2021.130337 | 2021 | Electrochemical aptasensor for simultaneous detection of foodborne pathogens based on a double stirring bars-assisted signal amplification strategy | Apt-S.T | TGGCTAGCTCAGTCATATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAGCCGCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a double stirring bar-based signal-amplified strategy using aptamer-embedded tetrahedral DNA nanostructures for the simultaneous electrochemical detection of Vibrio parahaemolyticus (V.P) and Salmonella typhimurium (S.T). | Display a lower detection limit of 7 CFU/mL for S.T. within a detection range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1587 | 33590378 | 2021 | Sensitive colorimetric aptasensor based on g-C3N4@Cu2O composites for detection of Salmonella typhimurium in food and water | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A colorimetric aptasensor using graphitic carbon nitride (g-C3N4) nanosheets and copper oxide(I) (Cu2O) nanocrystals was developed for detecting S. typhimurium. | Exhibited linear range from 1.5 × 10(1) to 1.5 × 10(5) CFU/ml, with a detection limit of 15 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1615 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G10-11 | CAACCTGCTTATCTAAGGGGGGGAGGGGGGGTTGTGGGTAGGT | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1616 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-6 | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1617 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-5 | ATACATCTTAAGTCTCGTGGGGGGAGGGGGGGTTGGTGGGCTTT | 44 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1618 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G11-20 | CTACGTCTAGATTCCAGTCGAGGGGGGAGGGGGGGTTTTGGATCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1619 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | SMa#G10-6 | ACACCAGCGTATTCTCTTGGGGGGAGGGGGGGTTGGGGGTCGGT | 44 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1620 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-1 | GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1621 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-2 | GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1622 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-3 | TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1623 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-4 | TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1624 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-5 | CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1625 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-6 | CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1626 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | ASM-7 | GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA | 39 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1627 | 36276899 | 2022 | Investigating the anti-streptococcal biofilm effect of ssDNA aptamer-silver nanoparticles complex on a titanium-based substrate | FAM | GCAATGGTACGGTACTTCCCAAAAGTGCACGCTACTTTGCTAA | 43 | N/A | ssDNA | Streptococcus Mutans (PTCC 1683) | Fibronectin/fibrinogen-binding protein (FBP) | Silver nanoparticles-aptamer complex (AptBH-AgNPs) that binds to the surface receptors of streptococcal strains and inhibits biofilm formation. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1630 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt2 | ATCCAGAGTGACGCAGCA-TGTGGTGTACGTATCATTTATGCTTTAATAGTGTGCCGTTGTTGCTTGCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1631 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt3 | ATCCAGAGTGACGCAGCA-TGACGGGTAGGACTTCCTGTGTTAGGTTGTAATGTTGGTGAAGCGTCCCG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1632 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt4 | ATCCAGAGTGACGCAGCA-TGGGGCCGGACAGGGCAAACTGGCTGAAGCGGAGGGTGTCGGCGCCGCTC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1633 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt5 | ATCCAGAGTGACGCAGCA-TGAGGGGAGGTAAGGGGTGAGCTCGCATGTACCGTTGGGAGAGGGGGGGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1634 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt6 | ATCCAGAGTGACGCAGCA-TGTGGGCAAGTCGGTGACGAACCAGGTGTCAAGGTCCTGCGCGCTCGCAC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1635 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt7 | ATCCAGAGTGACGCAGCA-TGGAGCGGTGGGCACGGTTGGGTCGCGTGGATGGAGGCGGGCGTGTGCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1636 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt8 | ATCCAGAGTGACGCAGCA-TGGGACGGTGCGGGGGAGGAGGATGAGCGTGGTCGTTGGGTGGCTGCCGC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1637 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt9 | ATCCAGAGTGACGCAGCA-CGAACGTTAGACGATTTGTGCAGTAGTGGCCACAGCCTAATCGTGTTGCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1638 | 36005012 | 2022 | Electrochemical Aptasensor for the Detection of the Key Virulence Factor YadA of Yersinia enterocolitica | Apt10 | ATCCAGAGTGACGCAGCA-TGCCAGTATGCCCACTCTCATTCGGCTTCTTTGTGTTGCATGTTACGCCC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Yersinia Enterocolitica (WA-314) | Virulence factor Yersinia adhesin A (YadA) | Identify an aptamer against YadA and develop an electrochemical biosensor for its detection. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1639 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA76 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG-5’ | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | N/A | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1640 | https:doi.org10.1016j.arabjc.2022.104274 | 2022 | Application of G-quadruplex aptamer conjugated MSNs to deliver ampicillin for suppressing S. aureus biofilm on mice bone | PA63 | 3’-ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAAT-5’ | 63 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | MSNs-APT-AMP nanosystem for antibiofilm activity against S. aureus biofilm. | No significant biofilm on the surface of the bone after 48 h treatment with 100 µg/mL of the three-component system. | N/A | N/A | N/A | Therapeutics | N/A | N/A | No significant toxicity at 100 µg/mL for MCF-7 cells in 48 h. | N/A | Best Candidate | N/A | N/A |
| ABdb_1651 | 35829778 | 2022 | An ultrasensitive sandwich-type electrochemical aptasensor using silver nanoparticle/titanium carbide nanocomposites for the determination of Staphylococcus aureus in milk | Apts | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 23656) | Whole cell | Developed a novel sandwich-type electrochemical aptasensor using AgNPs@Ti3C2 nanocomposites for the detection of S. aureus. | Showed a low detection limit (LOD) of 1 CFU/mL and a linear range of 52–5.2 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | 92.68% of the initial current of the aptasensor was reserved when stored for 15 days at 4°C. | N/A | N/A | N/A |
| ABdb_1655 | https://doi.org/10.1016/j.snb.2022.131654 | 2022 | Dual recognition and highly sensitive detection of Listeria monocytogenes in food by fluorescence enhancement effect based on Fe3O4@ZIF-8-aptamer | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a fluorescence enhancement effect-based detection strategy based on Fe3O4@ZIF-8@aptamer for L. monocytogenes. | The linear range for detection of pure culture was 1.4 × 10(1) to 1.4 × 10(7) CFU/mL, with a detection limit of 0.88 CFU/mL in about 70 min. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1656 | 36418544 | 2022 | Colorimetric detection of Pseudomonas aeruginosa by aptamer-functionalized gold nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a colorimetric biosensor using aptamer-functionalized AuNPs for identifying P. aeruginosa. | P. aeruginosa was detected after 5 h for concentrations from 10(8) to 10(5) CFU/mL, with 10(5) and 10(4) CFU/mL being the detection limits for colour change by the naked eye and UV-Vis spectrometry, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1658 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K3 | CCGGAATTCCTAATACGACTCCCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Determine the antibiofilm activity and binding specificity of the polyclonal DNA aptamers on S. aureus BPA-12 and E. coli EPEC 4. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (25.8%) and E. coli EPEC 4 (0.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1659 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K4 | CCGGAATTCCTAATACGACTCCCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCCTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (26.3%) and E. coli EPEC 4 (2.8%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1660 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K6 | CCGGAATTCCTAATACGACTCGCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against S. aureus BPA-12 (37.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1661 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K13 | CCGGAATTCCTAATACGACTCCACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (31.8%) and E. coli EPEC 4 (9.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1662 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K15 | CCGGAATTCCTAATACGACTCCAGGACAGTACTCTGGACGGCAATACGTATATACGTACGGTATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the percentage of antibiofilm activity against S. aureus BPA-12 (19.1%) and E. coli EPEC 4 (-1.3%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1663 | https://doi.org/10.48022/mbl.2206.06001 | 2022 | Antibiofilm Activity and Binding Specificity of Polyclonal DNA Aptamers on Staphylococcus aureus and Escherichia coli | S15K20 | CCGGAATTCCTAATACGACTCCCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 and Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Inhibition of biofilm formation by folding into unique three-dimensional structures and attaching to a specific target. | Showed the highest percentage of antibiofilm activity against E. coli EPEC 4 (15.4%). | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1680 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 36,70 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1681 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1682 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K6 has the highest binding affinity to S. aureus BPA-12. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17,01 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1683 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 60,69 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1684 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,90 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1685 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Staphylococcus aureus (S. aureus) BPA-12 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1686 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 28,06 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1687 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1688 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 31,99 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1689 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 5,21 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1690 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Escherichia Coli (E. Coli) EPEC 4 | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K13 and S15K15 have high binding affinity to E. coli EPEC 4. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 8,89 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1691 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1692 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K3 | CCGGAATTCCTAATACGACTC-CCAGCAGCAAGGTGCGGTACCCGGGGATGCGGGCTTGCTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,84 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1693 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K4 | CCGGAATTCCTAATACGACTC-CCCGGGCCCACAGGGTACGCGTCTGCGGCTGGCCGGTCCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1694 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K6 | CCGGAATTCCTAATACGACTC-GCGGGACGGGGAGTGCGCTGGGCATGTGGGCGCCGGGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20,79 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1695 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K13 | CCGGAATTCCTAATACGACTC-CACGCGCAGGCAGCCACCGACCAGGTGCTCGTATGGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | S15K3 and S15K13 have a high binding affinity for S. agalactiae. | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 6,53 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1696 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K15 | CCGGAATTCCTAATACGACTC-CAGGACAGTACTCTGGACGGCAATACGTATATACGTACGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 45,36 nM | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1697 | 35776386 | 2022 | A sequential toggle cell-SELEX DNA aptamer for targeting Staphylococcus aureus, Streptococcus agalactiae, and Escherichia coli bacteria | S15K20 | CCGGAATTCCTAATACGACTC-CCGGCGCCACGACATGGGCGCTGCCGGTGTGGTCGCGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Streptococcus Agalactiae | Whole cell | Isolate polyclonal DNA aptamer with broad reactivity to the mastitis bacteria S. aureus, S. agalactiae, and E. coli. | N/A | 15 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1698 | 35896842 | 2022 | Gold nanoparticles (AuNP)-based aptasensor for enteropathogenic Escherichia coli detection | S8-7 | CCGGAATTCCTAATACGACTCGGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 81 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | An AuNP-based aptasensor was developed for the detection of enteropathogenic Escherichia coli. | N/A | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 17.18 nM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1699 | 35896842 | 2022 | Gold nanoparticles (AuNP)-based aptasensor for enteropathogenic Escherichia coli detection | S8-7.2 | GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCATATTGAAAACGCGGCCGCGG | 60 | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | An AuNP-based aptasensor was developed for the detection of enteropathogenic Escherichia coli. | LOD value of AuNP-based aptasensor after overnight incubation with a value of 10(5) CFU/mL. | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1700 | 35896842 | 2022 | Gold nanoparticles (AuNP)-based aptasensor for enteropathogenic Escherichia coli detection | S10-5 | N/A | N/A | N/A | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | An AuNP-based aptasensor was developed for the detection of enteropathogenic Escherichia coli. | LOD of AuNP-based aptasensor was achieved at overnight incubation with a value of 10(6) CFU/mL. | N/A | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 34.14 nM | Biosensor | N/A | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1701 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-1 | CCGGAATTCCTAATACGACTC-TGCGGACTGTATCGGTCGGTCGAAAATAGTGAAGTGC-TATTGAAACGCGGCCGCGG | 77 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1702 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-4 | CCGGAATTCCTAATACGACTC-ACTACGCACGGCGCGAGTAAATCGATCATGGTACTGTGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1703 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S8-7 | CCGGAATTCCTAATACGACTC-GGTTCCGGTAAGATTAGATCATAACGTATGGCTAGCGCCA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1704 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S9-3 | CCGGAATTCCTAATACGACTC-GAAAACGTACCACTGGGATGGGTTGTGGGAGAGGGCCAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1705 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-1 | CCGGAATTCCTAATACGACTC-TATGGAGTTTGTCCGTATGATTACGTGATATCGCGACGGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1706 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-2 | CCGGAATTCCTAATACGACTC-CAGCAAACGCAGTCCAACAGCCGACAAACGGTCTTGAGGC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1707 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-5 | CCGGAATTCCTAATACGACTC-TACAAAAAGTCGTGGTCCAGTTGCCATGTGTAAAACTGTG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1708 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-6 | CCGGAATTCCTAATACGACTC-AACCAGACCACGCGAGAGGGCTCACAGTGAGACGTGAAGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1709 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-7 | CCGGAATTCCTAATACGACTC-TGGTGGGTAAAGACACCATACTGATAGTTACAAGGATGTT-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1710 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-8 | CCGGAATTCCTAATACGACTC-GCAACTTCAGTTCAGCAAGGTGCCGGCCACGCGACGGTCC-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | N/A | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1711 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-10 | CCGGAATTCCTAATACGACTC-ATCCAGCAGATGTGCGCGGGTTGGTGGGGGAACGGTGGGA-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1712 | 10.4308/hjb.29.6.789-798 | 2022 | Isolation of DNA Aptamers for Enteropathogenic Escherichia coli (EPEC) Detection using Bacterial-SELEX Approach | S10-15 | CCGGAATTCCTAATACGACTC-GTAGCACTATAGGCAGCACGAATATGGCCGTCGGAGTTGG-TATTGAAAACGCGGCCGCGG | 81 | 5'-CCGGAATTCCTAATACGACTC-N40-TATTGAAAACGCGGCCGCGG-3' | ssDNA | Enteropathogenic Escherichia Coli (E. Coli) (EPEC K1.1) | Whole cell | Identify aptamers against pathogenic E. coli EPEC K1.1. | G-quadruplex sequence motifs are found in the S9-3, S10-10 and S10-15 aptamer sequences, with G-scores of 40, 20 and 10 (2 motifs), and 13, respectively. | 10 | N/A | N/A | Detection | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1716 | 36205828 | 2022 | Aptamer-AuNP-conjugated carboxymethyl chitosan-functionalized graphene oxide for colorimetric identification of Salmonella typhimurium | S. typhimurium Aptamer | GCGCTCGGCCTCCTCTGCCATCTCATTCGCGAGCC | 35 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a novel aptamer-AuNP-conjugated carboxymethyl chitosan–functionalized graphene oxide (CMC/GO@Apt-Au NP) probe for the determination of S. typhimurium. | Achieved a linear range from 10(2) to 10(7) CFU/mL with a limit of detection (LOD) of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The relative response of aptasensor decreased to ~ 77% within 11 days of storage. | N/A | N/A | N/A |
| ABdb_1717 | 34693471 | 2022 | Electrochemical biosensor for detecting pathogenic bacteria based on a hybridization chain reaction and CRISPR-Cas12a | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An electrochemical biosensor platform based on HCR-based CRISPR-Cas12a for specific detection of S. typhimurium. | Selectively and sensitively quantify S. typhimurium in samples with detection limits of 20 CFU/mL and a linear range of 10-10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1727 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA25 (SA-9R-25) | GCTTCCAGCTTATTGAAT-GGGGAAGGTCGTCCGACGAACCCGGTCAGATAGGGTGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 44.92 ± 1.36 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1728 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA28 (SA-10R-28) | GCTTCCAGCTTATTGAAT-GCGGCCACGGAGGGGGTGCCGGGCGTGGAATAAGATGTGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 77 ± 1.22 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1729 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA35 (SA-10R-35) | GCTTCCAGCTTATTGAAT-CACAGGTGTGGGGAGGTCCCCATGGAGGTGGTTCAATG-GCGCTGAAGCGCGGAAGC | 74 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 58.77 ± 0.73 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1730 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA40 (SA-10R-40) | GCTTCCAGCTTATTGAAT-CGACGTGAAGCAATCATGGGTGGGGTACGTCGGGTCATGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | 126.95 ± 0.51 nM | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1731 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-12 | GCTTCCAGCTTTATGAAT-TGGGCGTGGCGACGGTGTCAGGTCGGGGCGGTAAGACGAGG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1732 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-9R-57 | GCTTCCAGCTTATTGAAT-GGAACGAGATGGGGCATGGCGCCACGGAGGGGAATCAAGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1733 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-1 | GCTTCCAGCTTATTGAAT-CGAGGGTAAGGGAAGTATGGCCGGTGCCCTGGAGTCAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1734 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-18 | GCTTCCAGCTTATTGAAT-CGGGTGGGGGGAGCGACAGACGGAAAAGCCTGGGTCAATAG-GCGCTGAAGCGCGGAAGC | 77 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1735 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-55 | GCTTCCAGCTTATTGAAT-GGAGGGGCAGGGCATGGAGCTCGACATTCATGAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1736 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-59 | GCTTCCAGCTTATGGAAT-GTGCCGAGGCGATACATGCACAGGCATGGTGGGATAAGGTCGGG-GCGCTGAAGCGCGGAAGC | 80 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1737 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-69 | GCTTCCAGCTTATTGAAT-CGGAGAGTCTGGCGCAGCCCTACGCCGATGTAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1738 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA-10R-72 | GCTTCCAGCTTATTGAAT-CGAGGTGTGGGAGACAACGCTCCGTGACCGAGGGGAAATG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1740 | 36108985 | 2022 | Naked-eye detection of Staphylococcus aureus in powdered milk and infant formula using gold nanoparticles | Anti-S. aureus aptamer (Apt1) | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (FPR3757 USA300) | Whole cell | Developed a colorimetric LSPR aptasensor using gold nanoparticles for the detection of S. aureus in milk and infant formula. | Could be visually detected within 30 min, with detection limits of 7.5 × 10(4) CFU/mL and 8.4 × 10(4) CFU/mL in milk and infant formula, respectively. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1744 | 35275270 | 2022 | DNAzyme-controlled plasmonic coupling for SERS-based determination of Salmonella typhimurium using hybridization chain reaction self-assembled G-quadruplex | Apt | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a SERS aptasensor based on hybridization chain reaction (HCR) self-assembled G-quadruplex DNAzyme (GQH DNAzyme)-controlled plasmonic coupling for S. typhimurium detection. | Display a linear range from 5 to 5.0 × 10(5) cfu/mL and the limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1750 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2 | ATCCAGAGTGACGCAGCA-TGTGGGGGCATGGGAAGGTGGGTAAGCCGTTGCGTGGGATGTGGCGGGTC-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1751 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt2_RC | ATCCAGAGTGACGCAGCA-GACCCGCCACATCCCACGCAACGGCTTACCCACCTTCCCATGCCCCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1752 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3 | ATCCAGAGTGACGCAGCA-TGGGGCGAAGGACGGTGGATGTGTGTAGGCGCGGGTGGGTCGCACGGGGT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1753 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt3_RC | ATCCAGAGTGACGCAGCA-ACCCCGTGCGACCCACCCGCGCCTACACACATCCACCGTCCTTCGCCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1754 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4 | ATCCAGAGTGACGCAGCA-TGACAGACGGGAGAGACACGACGGGGGCGGGGAGTGAGAAGCGCGCGCTG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1755 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt4_RC | ATCCAGAGTGACGCAGCA-CAGCGCGCGCTTCTCACTCCCCGCCCCCGTCGTGTCTCTCCCGTCTGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1756 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5 | ATCCAGAGTGACGCAGCA-TGTGGCGGTGGCAAGGTCGGTGGGTGCGGCGGCGTACCGGTGGTGGGGGG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1757 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt5_RC | ATCCAGAGTGACGCAGCA-CCCCCCACCACCGGTACGCCGCCGCACCCACCGACCTTGCCACCGCCACA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1758 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6 | ATCCAGAGTGACGCAGCA-TGACCGGCGGGGGGTGGTTCGCTGATAGGGCGTGTGGACCGGGGGTCGCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1759 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt6_RC | ATCCAGAGTGACGCAGCA-TGCGACCCCCGGTCCACACGCCCTATCAGCGAACCACCCCCCGCCGGTCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1760 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7 | ATCCAGAGTGACGCAGCA-TGGGCGGGTAGTGGGGCAACGTGAGCGCGTGGGGTGTGGCAGGCGTGGCT-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1761 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt7_RC | ATCCAGAGTGACGCAGCA-AGCCACGCCTGCCACACCCCACGCGCTCACGTTGCCCCACTACCCGCCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1762 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8 | ATCCAGAGTGACGCAGCA-AGATGACTTAGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1763 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt8_RC | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTAAGTCATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1764 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9 | ATCCAGAGTGACGCAGCA-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCATCGAGTGTA-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1765 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt9_RC | ATCCAGAGTGACGCAGCA-TACACTCGATGACACACTCTTTCCCTACACGACGCTCTTCCGATCT-AATGTCGTTGGTGGCCC | 81 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1766 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10 | ATCCAGAGTGACGCAGCA-TGGGTGTGGTGGCGCGGGTGGCGTGGTGCGTGTACAGCTGGTTGCGGGCG-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1767 | 36829672 | 2023 | Aptasensor for the Detection of Moraxella catarrhalis Adhesin UspA2 | Apt10_RC | ATCCAGAGTGACGCAGCA-CGCCCGCAACCAGCTGTACACGCACCACGCCACCCGCGCCACCACACCCA-AATGTCGTTGGTGGCCC | 85 | 5'-ATCCAGAGTGACGCAGCA-N50-AATGTCGTTGGTGGCCC-3' | ssDNA | Moraxella Catarrhalis (Bc5) | Ubiquitous Surface Protein A2 (UspA2) | Identify aptamers against and develop an electrochemical biosensor functionalized with an aptamer as a bioreceptor to detect UspA2. | N/A | 8 | Fluorescence Spectroscopy | N/A | Biosensor | Whole Cell-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1768 | https:doi.org10.1016j.snb.2023.134218 | 2023 | Dual-mode sensing platform based on aptamer-tunable catalytic activity of mesoporous polydopamine/MnO2 nanozymes for detecting S. aureus | SA31 | GCAATGGTACGGTACTTCCTCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGACAAAAGTGCACGCTACTTTGCTA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Colourimetric-electrochemical sensing platform to detect S. aureus based on a dual-modal strategy. | Shows a low detection limit in 3 CFU/mL with a linear range between 5 and 10(7) CFU/mL and in a real sample with the recovery of 95.15%− 115.28%. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1769 | 37164985 | 2023 | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating genetic algorithm to optimise computational screening method | Apt31 | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT | 41 | N/A | ssDNA | Pseudomonas Aeruginosa | Outer membrane protein BamA (β-barrel assembly machinery A) | Selecting antibacterial aptamers against the BamA protein in Pseudomonas aeruginosa by incorporating a genetic algorithm to optimise the computational screening method. | Treatment of P. aeruginosa with 10 µM Apt31 for 2 h resulted in a significant reduction in CFU/mL and growth percentage. | N/A | N/A | N/A | Therapeutics | In-silico Method | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1798 | 37187062 | 2023 | A universal bacterial sensor created by integrating a light modulating aptamer complex with photoelectrochemical signal readout | Peptidoglycan aptamer | GCAGTTGCGGGACAGGGAGTGCGCTGCTCCCC | 32 | N/A | ssDNA | Escherichia Coli (E. Coli) | Peptidoglycan | Developed a signal-on photoelectrochemical biosensor for detecting peptidoglycan. | Demonstrate a limit-of-detection of 82 pg/mL (13 pM) in buffer and 239 pg/mL (37 pM) in urine for peptidoglycan and 1913 CFU/mL for Escherichia coli in urine. | N/A | N/A | 0.415 ± 0.047 μM | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1823 | 36166924 | 2023 | Ultrasensitive multicolor electrochromic sensor built on closed bipolar electrode: Application in the visual detection of Pseudomonas aeruginosa | Aptamer | TTTTTCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 65 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 10145) | Whole cell | An ultrasensitive multicolour electrochromic platform based on a closed bipolar electrode (BPE) was developed for visual sensing of P. aeruginosa. | The detection limit was as low as 0.33 CFU/mL, and the linear range was 10(0)-10(8) CFU/mL within 30 min by the naked eye. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1829 | 37429429 | 2024 | Assessment of the growth inhibition and anti-biofilm activity of aptamer (PmA2G02) against Proteus mirabilis 1429T | PmA2G02 | ATTACTTACGCTATCTAAttttGCTGTAGGGGAGGAGGGTGGGTtttTTATCATCTGGTATGTTA | 65 | N/A | ssDNA | Proteus Mirabilis (1429T) | Biofilm | Inhibit biofilm formation, adhesion, and mobility, along with a reduction in biofilm-related genes, namely rsbA, fliC2 & fimD, in P. mirabilis. | Aptamer treatment resulted in a 50% reduction in biofilm thickness and a 2.29-fold and 1.34-fold decrease in mRNA expression of the fliC2 and fimD genes, respectively. | N/A | N/A | N/A | Therapeutics | Whole Cell-SELEX | N/A | Aptamer treatment did not significantly affect cell viability. | N/A | N/A | N/A | N/A |
| ABdb_1830 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Apt1 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (RN4220) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.7 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1831 | 38250355 | 2024 | Rapid Detection and Identification of Vancomycin-Sensitive Bacteria Using an Electrochemical Apta-Sensor | Sp14 | AGCAGCACAGGGTCAGATGATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCACCTATGCGTG | 69 | N/A | ssDNA | Bacillus Cereus (ATCC 14579) | Whole cell | A portable electrochemical biosensor was developed for the identification of Gram-positive bacteria based on a vancomycin-modified screen-printed carbon electrode. | Demonstrated that capture was achieved in 10 min, with a limit of detection of only 2.4 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1848 | 38452591 | 2024 | Aptamer-mediated double strand displacement amplification with microchip electrophoresis for ultrasensitive detection of Salmonella typhimurium | Aptamer (Apt) | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-mediated double SDA-MCE method for ultrasensitive detection of S. typhimurium. | Achieved a linear range of 30–1.0 × 10(5) CFU/mL and the limit of detection for S. typhimurium down to 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1854 | 39096325 | 2024 | Colorimetric aptasensor for Listeria monocytogenes detection using dual functional Fe3O4@MIL-100(Fe) with magnetic separation and oxidase-like activities in food samples | Aptamer | TACTATCGCGGGAGACAGCGCGGGAGGCACCGGGGA | 36 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Whole cell | Developed a colorimetric aptasensor based on magnetic responsiveness and oxidase-like activity of Fe3O4@MIL-100(Fe) for the detection of L.monocytogenes. | The linear range was from 10(2) to 10(7) CFU/mL, with the limit of detection as low as 14 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1873 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 3 (Ap3) | NNNNNNNNNNNNNNNNNNNNNGGGGGCTTTCAAGGGCGCGACGAAGCTGTTTTATTCTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | Achieved a detection limit of 0.1 ag/mL EC proteins (equivalent to 3 protein particles per mL) within 120 min from the plasma sample. | 15 | Isothermal Titration Calorimetry (ITC) | 8.30 x 10-7 M | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1874 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 1 (Ap1) | GACGTTTTGCAAGTGCGGCTACTACAAGCGAAGTTCCATCATTTTAGAGTCATAAACGC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1875 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 6 (Ap6) | CCGCCTGGAAGGCATTTCGCCGGGAAGACCCACGTCACTCCTCCCCTGAACTTCGGTTC | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1876 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 2 (Ap2) | TATACATTGATTTATCGGACCACTGCAGTACCACGCAGGATGGACGGCCATCGTTAATA | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1877 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 4 (Ap4) | TAGGATTCGTTTATTCGTGGGGCTGTAGTTCCGATAAAACCGCCAAGGGATCGTTGCCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1878 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 5 (Ap5) | ATTAGATGTAAAACGCCACGGGTAGCAGTTAAAGTCGTATTTATAGGCACAACGAAGAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1879 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 7 (Ap7) | CAATTAGACAGGCTCTAAGCTTTGGACCCAGCGTAGAAAGTTTGTTATTTCTTCGGGCT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1880 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 8 (Ap8) | ATAAGCTTTTTAAGGCAAGGACGCGGCCCGGTACTTGCGTTGGAGGAATCTTAAGTTAT | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1881 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 9 (Ap9) | CATTTATAACTACGATTGTGGTCACATTCCGTGGATGGAATCACTTCTCAGGTGCCGAG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1882 | 40359808 | 2025 | Plasma-based ultrasensitive detection of Mycobacterium tuberculosis ESAT6/CFP10 fusion antigen using a CRISPR-driven aptamer fluorescence testing (CRAFT) | Aptamer 10 (Ap10) | TGTTTACACATATTCTTGCGCATTACTTGCTTTGGCATTATCTGTATCCCCCTCAGCGG | 59 | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | ESAT6/CFP10 fusion proteins (EC proteins) | Develop a CRAFT (CRISPR-Driven Aptamer Fluorescence Testing) assay designed for the rapid and sensitive detection of M.tb. antigens from peripheral blood. | N/A | 15 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1890 | 40308970 | 2025 | Aptamer-functionalized graphene quantum dots combined with artificial intelligence detect bacteria for urinary tract infections | Aptamer | CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Develop an aptamer-functionalized graphene quantum dots integrated with an artificial intelligence detection system (AG-AI detection system) for the detection of E. coli. | Exhibits a wide linearity (10(3)-10(9) CFU/mL) and a low detection limit (3.38×10(2) CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1905 | 41123678 | 2025 | Portable AI-driven electrochemical aptasensor for real-time Staphylococcus aureus detection in food and beverages | IsdA-specific aptamer | GCGCACGCGUGUGUAGUACACACGAUCGCGCGCACAAUAU | 40 | N/A | ssRNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Iron-regulated Surface Determinant Protein A (IsdA) | Developed a portable electrochemical aptasensor integrated with machine learning using SPCE/AuNPs for the detection of S. aureus in food and beverage samples. | The lowest detection limit for S. aureus was 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1906 | 40947925 | 2025 | Smartphone-Based Fluorescence/Colorimetric Dual-Mode Aptasensor for the Detection of Salmonella Using Multivalent Aptamer and CHA Amplification | Aptamer | GTGAGAGTGGGTCATCGAAAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a dual-mode portable fluorescent/colorimetric aptasensor, leveraging multivalent aptamer competitive assays and catalytic hairpin assembly (CHA) for the detection of Salmonella. | Enables the quantitative detection of Salmonella within a linear range of 10 to 10(7) CFU/mL, with detection limits of 28 CFU/mL for colorimetric detection and 10 CFU/mL for fluorescent detection. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1907 | 41149287 | 2025 | Real-Time and Selective Detection of Pseudomonas aeruginosa in Beef Samples Using a g-C3N4-Doped Multimetallic Perovskite-Based Electrochemical Aptasensor | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on aptamer functionalized FeCoCuNiO-g-C3N4 nanocomposite for the detection of P. aeruginosa in food samples. | Exhibited a low detection limit of 3.03 CFU/mL and over a range of 1 × 10(1)–1 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1912 | 40437283 | 2025 | Target-triggered hybrid chain amplified fluorescence aptasensor based on label-free dye and MnO2 nanosheets system for Escherichia coli detection | AwI | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACCTGTACAAATCGTCTTGAT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | Developed a label-free fluorescent detection system leveraging target-triggered hybridization chain reaction (HCR) amplification for E. coli detection. | Exhibited a detection limit of 17 CFU/mL and a broad dynamic range from 5.0 × 10(1) ~ 5.0 × 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1913 | 40187870 | 2025 | 3D DNA walkers integrated with self-reporting MOFs: Pioneering ratiometric electrochemical sensing for Staphylococcus aureus | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a ratiometric electrochemical aptasensor utilizing a magnetic 3D DNA walking machine and self-assembly of MOF for the sensitive detection of S. aureus. | Demonstrates a detection range from 10 to 2 × 10(5) CFU/mL and achieves a low LOD of 2.3 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | After a duration of seven days, the ratio value maintained 91.89% of its initial intensity. | N/A | N/A | N/A |
| ABdb_1931 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(S) | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (KCTC 1925) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.2 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1932 | 39961826 | 2025 | Self-protective DNAzyme-based dual-responsive three-way Y-probe for simultaneous determination of multiple pathogenic bacteria | APT(E) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACACCTACCCATCGGA | 54 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (KCTC 2571) | Whole cell | Developed a DNAzyme-based self-protecting dual-response three-way Y nanoprobe (SD-DTY) for the simultaneous detection of two foodborne pathogens. | The limit of detection was 3.7 cfu/mL, and the linear range was 10-10(5) cfu/mL, with a 2-hour response time. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1933 | https://doi.org/10.1016/j.snb.2024.136609 | 2025 | Ultrasensitive electrochemical biosensor for bacteria detection based on Fe3O4@COF-AuNPs and trigging isothermal circular amplification | Aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an ultrasensitive electrochemical biosensor based on magnetic nanocomposite material Fe3O4@COF-AuNPs and triggering isothermal circular amplification (TICA) for E. coli detection. | The detection limit (LOD) was 10 CFU/mL, with a linear range of 10(2)−10(9) CFU/mL, and the detection time was 1 h. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The sensor was stored at 4°C, and the signal value decreased by only 6.28 % over 30 days. | N/A | N/A | N/A |
| ABdb_1956 | 17344350 | 2007 | Development and characterization of monoclonal antibodies and aptamers against major antigens of Mycobacterium avium subsp. paratuberculosis | Aptamer 94 | N/A | N/A | 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-N40-ATTTCTCCTACTGGGATAGGTGGATTAT-3' | ssDNA | Mycobacterium Avium subsp. paratuberculosis (ATCC 19698) | MAP0105c gene product | Identify aptamers that were screened against the MAP0105c gene product. | Bound specifically to the N-terminal half of MAP0105c, and nearly all mycobacteria tested. | 12 | N/A | N/A | Detection | Counter-SELEX | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_1970 | 23381690 | 2013 | Selection of aptamers against inactive Vibrio alginolyticus and application in a qualitative detection assay | Pool of enriched aptamers | N/A | N/A | 5'-TCAGTCGCTTCGCCGTCTCCTTC-N35-GCACAAGAGGGAGACCCCAGAGGG-3' | ssDNA | Vibrio Alginolyticus | Whole cell (Inactivated) | Identify aptamers against and qualitatively detect inactive Vibrio alginolyticus using PCR. | V. alginolyticus could be detected at 100 cells/ml. | 15 | Micro-Fluorospectrophotometer (Fluorescence Spectroscopy) | 27.5 ± 9.2 nM | Detection | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2118 | 30382404 | 2018 | A bimodal (SERS and colorimetric) aptasensor for the detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | N/A | N/A | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | The dual-mode aptasensor based on SERS and colorimetry assay for the determination of P. aeruginosa. | LOD of the aptasensor was 20 cfu/mL for SERS mode and 50 cfu·mL−1 for color mode with a linear range from 10^2 cfu/mL to 10^6 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2120 | https://doi.org/10.1016/j.jelechem.2018.07.002 | 2018 | Target-induced aptamer displacement on gold nanoparticles and rolling circle amplification for ultrasensitive live Salmonella typhimurium electrochemical biosensing | S. typhimurium (STM)-binding aptamer. | N/A | N/A | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop an aptasensor for ultrasensitive detection of live S. typhimurium by combining target-induced aptamer displacement on gold nanoparticles (AuNPs) deposited electrode with rolling circle amplification (RCA). | Showed a LOD of 16 CFU/mL with a wide linear detection range of 20 to 2 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | When the sensor was stored at 4°C for 10 days, the electrical signal response was 90% of that obtained at the time of preparation. | N/A | N/A | N/A |
| ABdb_2123 | 33395571 | 2021 | Aptasensor for the detection of Methicillin resistant Staphylococcus aureus on contaminated surfaces | AT0033 | N/A | N/A | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) (ATCC 25923) | Penicillin binding protein 2a (PBP2a) | Developed a colorimetric aptasensor for the detection of MRSA on contaminated surfaces. | The visual detection limit was less than 100 CFU/ml and, theoretically, 2 CFU/ml, while the linear range of quantitation was 10(2)–10(5) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2129 | 35765498 | 2022 | Single-stranded DNA aptamer-based rolling circle amplification as anti-chicken Salmonella bacteriostatic | Anti-Salmonella DNA aptamer | N/A | N/A | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) and Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify an aptamer targeting Salmonella in the form of RCA-p that could inhibit bacterial growth, multiplication, and viability. | Significant reduction in bacterial viability. | N/A | N/A | N/A | Therapeutics | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| ABdb_2130 | 37773421 | 2023 | Sensitive detection of Escherichia coli in diverse foodstuffs by electrochemical aptasensor based on 2D porphyrin-based COF | Aptamer | N/A | N/A | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed an electrochemical aptasensor using two-dimensional porphyrin-based covalent organic framework (Tph-TDC-COF) for the detection of E.coli. | Demonstrated an extremely low detection limit of 0.17 CFU/mL for E.coli detection within a linear range of 10 to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | The aptasensor recovered to 104.3% after 15 days of storage at 4°C in 0.01 M phosphate buffer, indicating excellent stability. | N/A | N/A | N/A |
| ABdb_2131 | https://doi.org/10.1016/j.bioana.2024.05.004 | 2024 | Aptamer-carbon quantum dots and silver nanoparticles construct a FRET sensor for sensitive detection of E. coli | E. coli aptamer | N/A | N/A | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Whole cell | Developed a FRET-based fluorescent biosensor by combining CQDs with Ag NPs for the rapid detection of E. coli (BL21). | The sensor has a linear range of 2×10(3) ∼ to 2×10(8) CFU/mL and a low detection limit of 77 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | N/A | N/A | N/A | N/A | N/A | N/A |