Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1800 | https://doi.org/10.1002/celc.202300257 | 2023 | Rolling Circle Amplification/G-Quadruplex-Based Dual-Signal Ratiometric Electrochemical Aptasensor for Ultrasensitive Detection of Pathogenic Bacteria | Aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 87 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923 and ATCC 29213) | Whole cell | Developed a ratiometric dual-signal electrochemical biosensor for ultrasensitive detection of S. aureus based on an aptamer recognition-induced rolling circle amplification (RCA)/G-quadruplex strategy. | Showed a good linear relationship between 10–10(6) CFU/mL with a detection limit of 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | Ferrocene (Fc) conjugated | N/A | N/A | N/A | N/A | N/A |