Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 50
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0083 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence A | GCCCAATCGCCGTCTTCTACA-TGTGCGTGTGTCAGCGAATATCACCTAGAGGTCGG-AGTGCCAACGCCCTCCTGAT | 76 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0084 | https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456 | 2010 | In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX | Sequence B | CCCAATCGCCGTCTTCTACA-TGTATGCTGCCGAGGTTGGCCTCTTAGTCAGCTGAGAGTGCCAACGCCCTCCTGATATGCCCAATCGCCGTCTTCTACATTGTGGTCGTGGGAATGCATTCATCCGTTGCCGG-AGTGCCAACGCCCTCC | 149 | 5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify a high-affinity aptamer against Vibrio alginolyticus. | Bind to different sites of the V. alginolyticus surface. | 15 | N/A | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0459 | 25437803 | 2014 | Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold | EcO 3R | CACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) and Escherichia Coli (E. Coli) O157:H7 | Whole cell | Sandwich (EcO 3R/4F) Lateral Flow Assay (aptamer-Qdot LF strip) for the detection of E.coli. | Sandwich combination (EcO 3R-conjugate and EcO 4F-capture aptamer) yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3′-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | U.S. Patent Application 13/136,820 |
| ABdb_0586 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-1 | CGGATCCATGGGCACTATTTATATCAA-TATGCCAGCATTTCGCCAACGGTGGTCATACAGTGTGAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0587 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-2 | CGGATCCATGGGCACTATTTATATCAA-GGGTATCCCACTCGGACGTTCATACCTGGCTGGTTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0588 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-3 | CGGATCCATGGGCACTATTTATATCAA-AGCGCGTTTTGGACATGCGCTAGCTTCAATTTGAGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0589 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-4 | CGGATCCATGGGCACTATTTATATCAA-GCCAATGCACTCTGGTTATTCCCCTAAACATCCCGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0590 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-5 | CGGATCCATGGGCACTATTTATATCAA-CGTTTGGGGCTGTGTTGCAAGACCGTACGTTGCCCCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0591 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-6 | CGGATCCATGGGCACTATTTATATCAA-TGCAACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0592 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-7 | CGGATCCATGGGCACTATTTATATCAA-TGGTACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0593 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | APG-8 | CGGATCCATGGGCACTATTTATATCAA-TTACAGTATCCTCCCACGTTGGTTCGTGTCTTACGGAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Porphyromonas Gingivalis (ATCC 33277) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 APG aptamers were effectively bound to P. gingivalis cells; 3 out of 8 aptamers showed slight binding to the lysates of T. denticola pellet. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0594 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-1 | CGGATCCATGGGCACTATTTATATCAA-CCCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0595 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-2 | CGGATCCATGGGCACTATTTATATCAA-GGCTAGGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0596 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-3 | CGGATCCATGGGCACTATTTATATCAA-CCTTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0597 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-4 | CGGATCCATGGGCACTATTTATATCAA-GGCGTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0598 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-5 | CGGATCCATGGGCACTATTTATATCAA-CTGCACGTGGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0599 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-6 | CGGATCCATGGGCACTATTTATATCAA-GACTACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0600 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-7 | CGGATCCATGGGCACTATTTATATCAA-GCCATTCGTCACTGAGTTGCTCTAGTGCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0601 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ATD-8 | CGGATCCATGGGCACTATTTATATCAA-CTAAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Treponema Denticola (ATCC 33521) | Whole cell | Screen and develop aptamers specific to oral pathogens. | All 8 ATD aptamers bound to the cell lysates of T. denticola, some showed cross-binding to P. gingivalis and E.coli, but not to S. mutans. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0602 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-1 | CGGATCCATGGGCACTATTTATATCAA-GCATCGGTCCTGAAGTTGCTCTAGTGCCCGTGTGCTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0603 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-2 | CGGATCCATGGGCACTATTTATATCAA-GGGCTAGCCCCGGATCACCACTTTCCCTGCTTGATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0604 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-3 | CGGATCCATGGGCACTATTTATATCAA-TGTAACGGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0605 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-4 | CGGATCCATGGGCACTATTTATATCAA-TGGCACCGTGGAGTCGTGTTGAGGAGGCGCAATGCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0606 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-5 | CGGATCCATGGGCACTATTTATATCAA-CCTAACGTTCTCTCCTCGCTCCTCAAGGAGCCACGCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0607 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-6 | CGGATCCATGGGCACTATTTATATCAA-CGGTTTTCGCGCTATTTCCGTACAACCCGCGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0608 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASM-7 | CGGATCCATGGGCACTATTTATATCAA-GTGTTTCGCGCTATTTCCGTACAACCCGCGGACGCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASM showed selective binding to S. mutans cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0609 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-1 | CGGATCCATGGGCACTATTTATATCAA-CCTCACATAGTGACGATGTGGTTTGGTACCTCTATGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0610 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-2 | CGGATCCATGGGCACTATTTATATCAA-CCGTGGATGTACGAAATTAACCGCACACCTAGCTACCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0611 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-3 | CGGATCCATGGGCACTATTTATATCAA-CGCATGCTTCTCGGGATACGGGCGGCTCGATAGAGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0612 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-4 | CGGATCCATGGGCACTATTTATATCAA-GCTTACTACGTTTGCCTCAGTGTGTTCCGGTCTTAACAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0613 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-5 | CGGATCCATGGGCACTATTTATATCAA-CCCATACCTTTTTCGATAGTAAGTGCCATGCCCATCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0614 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-6 | CGGATCCATGGGCACTATTTATATCAA-GCCTAGAACCCCCTGTCTAGTCAAGTAGTGCGAGTGCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0615 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-7 | CGGATCCATGGGCACTATTTATATCAA-GCCTTACCGCTCTATCACTCGTCTGTTGCCACTCAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0616 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-8 | CGGATCCATGGGCACTATTTATATCAA-TGCGCCGATAGTTTCGATCATGATGCATCTGGCTGTCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0617 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASO-9 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Oralis (ATCC 10557) | Whole cell | Screen and develop aptamers specific to oral pathogens. | ASO showed selective binding to S.oralis cell lysates without cross-reaction to the cell lysates of P. gingivalis or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0618 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-1 | CGGATCCATGGGCACTATTTATATCAA-TTGCTACAGGTATTGCACAACCTCGTGTGGTGTCCGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0619 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-2 | CGGATCCATGGGCACTATTTATATCAA-CGGTAGTACTACTGGAGACAACTTCGCATACTTTAGTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0620 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-3 | CGGATCCATGGGCACTATTTATATCAA-GCTGGCAACTGGATGCACTCGTCCTCAGCCTCGGTCAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0621 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-4 | CGGATCCATGGGCACTATTTATATCAA-GCCCGTGAGACTATACCCTATGCACTAGTTGCGTAATAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0622 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-5 | CGGATCCATGGGCACTATTTATATCAA-GCTCGCGTCTGAGGGAAGTTACGTTATTTCGCTTGTAAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0623 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-6 | CGGATCCATGGGCACTATTTATATCAA-CCGGACTTTAAGCGGCTTCTCGTGGCTGGGTAATCCTAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0624 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-7 | CGGATCCATGGGCACTATTTATATCAA-CCTGACCGATGTTGTATTAATGGCTCCGGGTCTTATGAG-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0625 | 25269812 | 2015 | Screening and development of DNA aptamers specific to several oral pathogens | ASS-8 | CGGATCCATGGGCACTATTTATATCAA-CGAGGGGTTGGTTTGTGGTGTTGCCGCCACTACAGCCAA-AATGTCGTTGGTGGCCC | 83 | 5'-CGGATCCATGGGCACTATTTATATCAA-N40-AATGTCGTTGGTGGCCC-3' | ssDNA | Streptococcus Sanguis (ATCC 10556) | Whole cell | Screen and develop aptamers specific to oral pathogens. | Several ASS aptamers showed cross-reactions with lysates of P. gingivalis and/or T. denticola. | N/A | Modified Western Blot Assay | N/A | Detection | Whole Cell-SELEX | DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0709 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #7 | TCAGTCGCTTCGCCGTCTCCTTC-GGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG-GCACAAGAGGGAGACCCCAGAGGG | 79 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #7 for inactivated V. alginolyticus was 10 cells/ml. | N/A | Fluorescence Spectroscopy | 28.39 ± 11.46 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0710 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #8 | TCAGTCGCTTCGCCGTCTCCTTC-AGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG | 82 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #8 for inactivated V. alginolyticus was 10 cells/ml. | N/A | Fluorescence Spectroscopy | 12.82 ± 6.00 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0711 | https://doi.org/10.1016/j.lwt.2015.07.021 | 2015 | Identification and characteristics of aptamers against inactivated Vibrio alginolyticus | Aptamer #23 | TCAGTCGCTTCGCCGTCTCCTTC-GTAGGAGGTAGTCGGAGAGGCGAATGAGAGGGGAAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG | 94 | N/A | ssDNA | Vibrio Alginolyticus | Whole cell | Develop an aptamer detection assay for inactivated V. alginolyticus. | The detection limit for aptamer #23 for inactivated V. alginolyticus was 10(3) cells/ml. | N/A | Fluorescence Spectroscopy | 46.89 ± 15.87 nM | Detection | N/A | 5'-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_2113 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA05 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2114 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | PA08 | N/A | N/A | N/A | ssDNA | Streptococcus Pneumoniae | Surface-specific Protein PavA | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2115 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH05 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor. | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2116 | https://doi.org/10.1016/j.snb.2017.02.098 | 2017 | Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators | FH08 | N/A | N/A | N/A | ssDNA | Neisseria Meningitidis | Surface-specific Protein FHbp | Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis. | N/A | 8 | Enzyme-Linked Oligonucleotide Assay (ELONA) | N/A | Detection | SELEX | 5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU)) | N/A | N/A | N/A | N/A | N/A |