Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0712 | https://doi.org/10.1080/00032719.2015.1052974 | 2015 | Determination of Shigella flexneri by a Novel Fluorescent Aptasensor | Aptamer1 | CCTCATGTCGAACAGCAACACTGCAACACTGTATAGTCCTGTGTGCCTTGAGCGTTTATTCTGAGCT | 67 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed a homogeneous fluorescent aptasensor using a dye-labelled aptamer and graphene oxide, using target recycling amplification for Shigella flexneri detection. | A linear relationship was displayed from 500 to 10(9) CFU/mL with a limit of detection of 100 CFU/mL. | N/A | N/A | 29 ± 4 nM | Biosensor | N/A | Carboxyfluorescein-GGGCCC at the 5' and 3' ends | N/A | N/A | N/A | N/A | N/A |