Modification : Amidation (NH₂)

Total records found: 111

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0054 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 2FCATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/ABest CandidateN/AN/A
ABdb_0055 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 5RGATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs.5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/ABest CandidateN/AN/A
ABdb_0056 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 2RGATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG605'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.N/A5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/AN/AN/AN/A
ABdb_0057 186712602009Preliminary development of DNA aptamer-Fc conjugate opsoninsα-PDGA 5FCATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC615'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3'ssDNABacillus Anthracis (BA)Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsuleIdentify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins.N/A5Colorimetric Peroxidase-Based Aptamer Plate Binding AssayN/ATherapeuticsMagnetic Bead (MB)-based SELEX5'-Amidation (NH₂) and 5'-BiotinylatedCell viability ranged from 90% to 95% in all experiments.N/AN/AN/AN/A
ABdb_0143 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E17F-72ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.N/AN/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/AN/AN/AN/A
ABdb_0144 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E17F-37ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT37N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/AN/AN/AN/A
ABdb_0145 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E18R-72ATACGGGAGCCAACACCATTCTATCGTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGGAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.N/AN/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/AN/AN/AN/A
ABdb_0146 231450452012An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7E18R-42CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7.Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and FITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_0336 242670762013A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labelsApt1ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT87N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellAptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria.For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved.N/AN/AN/ABiosensorWhole Cell-SELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0337 242670762013A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labelsApt2ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT87N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellAptamer-modified Quantum Dots (QD-apt) were developed for selective bacterial capture.For S. typhimurium, a linear range obtained between the concentrations 3.8 × 10(4) to 3.8 × 10(7) cfu/mL was obtained with QD 585-apt 2-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved.N/AN/AN/ABiosensorWhole Cell-SELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0427 242800492014Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteriaE1GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (KCTC 2571)Surface proteinDeveloped an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).N/AN/A12.4 nMBiosensorN/A5'-FAM Labeled and 3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0428 242800492014Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteriaE2GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (KCTC 2571)Surface proteinDeveloped an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).N/AN/A25.2 nMBiosensorN/A5'-FAM Labeled and 3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0429 242800492014Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteriaE10GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA90N/AssDNAEscherichia Coli (E. Coli) (KCTC 2571)Surface proteinDeveloped an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).N/AN/A14.2 nMBiosensorN/A5'-FAM Labeled and 3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0430 245686252014Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labelsApt₁GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers.The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 25 cfu/mL for S. aureus.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0431 245686252014Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labelsApt₂ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT87N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellDeveloped a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers.The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 10 cfu/mL for V. parahemolyticus.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0432 245686252014Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labelsApt₃ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT87N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Whole cellDeveloped a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers.The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 15 cfu/mL for S. typhimurium.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0461 https://doi.org/10.1007/s00604-014-1406-32014Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles.Apt1 ( V. parahaemolyticus aptamer)ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT87N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellDevelop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium.LOD: 25 cfu/mL and linear range from 50 to 10(6) cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0462 https://doi.org/10.1007/s00604-014-1406-32014Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles.Apt2 (S. typhimurium aptamer)ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT87N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 14028)Whole cellDevelop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium.LOD: 35 cfu/mL and linear range from 50 to 10(6) cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0500 250162532014Evanescent wave DNA-aptamer biosensor based on long period gratings for the specific recognition of E. coli outer membrane proteinsAptamerGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG36N/AssDNAEscherichia Coli (E. Coli) (ATCC® 8739™)Outer membrane protein (OMP)A label-free remote evanescent wave fibre optic sensor using long-period gratings (LPGs) was developed for the detection of EcOMPs.Displayed linear responses in the range of 0.1 nM to 10 nM EcOMPs and LOD of 10 nM in less than 1 h.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0538 256243252015Neutralization of staphylococcal enterotoxin B by an aptamer antagonistA11ATACCAGCTTATTCAATT-TAGGCGGTGGAGATAGTAAGTGCAATCTAGGCGGTGGAGATAGTAAGTGCAATCTATGCC-AGATAGTAAGTGCAATCT965'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3'ssDNAStaphylococcus aureus (S. aureus)Staphylococcal Enterotoxin B (SEB)Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro.Inhibited SEB-mediated PBMC proliferation of 93% and TNF-α, IL-1β, IL-6, IL-2, and IFN-γ in culture supernatants were reduced by 77, 97, 64, 96, and 99%, respectively. 90% survival of mouse models of SEB-induced TSS.11Fluorescence Spectroscopy64 nMTherapeutics/ImmunmodulatorySELEX5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FITC LabeledShowed no cytotoxic effects on PBMCs.N/AN/AN/AN/A
ABdb_0552 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU405'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells.8Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI)95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/A76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h.N/A~52 h for fmA12.N/A
ABdb_0553 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmF07AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC405'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)38.9 ± 4.1 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/ABest CandidateN/AN/A
ABdb_0554 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmE09AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC395'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)418 ± 112 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0555 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmG12UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA405'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI)475 nM (by SPR) and 220 ± 24 nM (by BLI)Targeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0556 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12Δ3N/AN/A5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)69.7 ± 3.5 nMTargeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0557 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12Δ6N/AN/A5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)63.1 ± 7.3 μMTargeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0558 254437902015Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterialsfmA12Δ9N/AN/A5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3'ssRNAStaphylococcus aureus (S. aureus)Staphylococcus aureus Protein A (SpA)Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing.N/A8Bio-Layer Interferometry (BLI)69.1 ± 16.7 nMTargeted Delivery/TherapeuticsSELEX2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0654 255909732015Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenesLMCA2ATACCAGCTTATTCAATT-CCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCG-AGATTGCACTTACTATCT765'-ATACCAGCTTATTCAATT-N40-AGATTGCACTTACTATCT-3'ssDNAListeria Monocytogenes (ATCC 19115)Listeriolysin O (LLO) proteinDeveloped an aptamer-based sandwich assay (ABSA) platform to distinguish L. monocytogenes from other Listeria species and other bacterial genera.Exhibited a linear response from 20 to 2×106 CFU per mL with a LOD of 20 CFU/mL.10Surface Plasmon Resonance (SPR)2.01×10(-12) MBiosensorWhole Cell-SELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0675 https://doi.org/10.1007/s00604-015-1649-72015Impedimetric Salmonella aptasensor using a glassy carbon electrode modified with an electrodeposited composite consisting of reduced graphene oxide and carbon nanotubesAnti-Salmonella aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 50761)Whole cellDevelop a label-free impedimetric aptasensor based on an amino-modified aptamer bound to rGO-MWCNT composite for the detection of Salmonella.Exhibits a linear range from 75 to 7.5 × 10(5) cfu/mL and a detection limit of 25 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0756 271794222016Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonistS3ATACCAGCTTATTCAATT-CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG-AGATAGTAAGTGCAATCT765'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAStaphylococcus aureus (S. aureus)Staphylococcal Enterotoxin A (SEA)Identify aptamers that bind to and block superantigen activity of SEA.Inhibited PBMCs proliferation with an inhibition rate of 84% and reduced IFN-γ, TNF-α, IL-2, and IL-6 secretions by 89%, 87%, 73%, 69%, respectively. PEGS3 allowed 79% of the mice to survive the lethal challenge.9Enzyme-Linked Aptamer Assay (ELAA)36.93 ± 7.29 nMTherapeutics/ImmunmodulatorySELEX5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FAM LabeledN/AN/AN/AN/AN/A
ABdb_0773 274278912016An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteriaE1GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli)Whole cellComposite (TiO2-Apc) for enhanced photodynamic inactivation of target-specific bacteria.TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation.N/AFluorescence Spectroscopy12.4 nMTherapeuticsN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0774 274278912016An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteriaE2GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli)Whole cellEnhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles.TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation.N/AFluorescence Spectroscopy25.2 nMTherapeuticsN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0775 274278912016An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteriaE10GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA90N/AssDNAEscherichia Coli (E. Coli)Whole cellEnhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles.TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation.N/AFluorescence Spectroscopy14.2 nMTherapeuticsN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0805 273185662016Staphylococcus aureus detection in blood samples by silica nanoparticle-oligonucleotides conjugatesAptamerGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT45N/AssDNAStaphylococcus aureus (S. aureus)Whole cellAptamer-functionalized silica magnetic nanoparticles-based assay for on-site determination of S. aureus.Detects S. aureus cells as low as 682 CFU in whole blood, with a linear range from 800 CFU/ml blood to 104 CFU/ml blood.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0808 268949872016Diazonium-based impedimetric aptasensor for the rapid label-free detection of Salmonella typhimurium in food sampleAptamer (N45)TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT96N/AssDNASalmonella Typhimurium (S. Typhimurium)Outer membrane protein (OMP)Developed a label-free impedimetric aptamer-based biosensor for S. typhimurium detection.Rapid (30 min) detection with a concentration range of 1×10(1) to 1×10(8) CFU/mL and limit of detection (LOD) of 6 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0823 280693772017Development of an aptamer-ampicillin conjugate for treating biofilmsAptamer 3GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC78N/AssDNASalmonella CholeraesuisFlagellaAptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation.Biofilms containing the conjugate had the lowest survival ratio (37.22 ± 1.12%) compared with control conjugates.14Fluorescence Spectroscopy41 ± 2 nMTherapeuticsWhole Cell-SELEX3'-Amidation (NH₂) and 5'-FITC LabeledN/AN/ABest CandidateN/AN/A
ABdb_0898 285135592017Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor PlatformSS-4ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT775'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNAShigella Sonnei (KCTC 2518)Whole cellIdentify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells.Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei.8Surface Plasmon Resonance (SPR)15.89 ± 1.77 nMBiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_0934 278258862017Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detectionE.coli aptamerGCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (ATCC 8739)Whole cellUpconversion nanoparticles (UCNPs) based FRET aptasensor (UCNPs-cDNA from AuNPs-aptamers) for detecting E. coli in tap/pond water and milk.Display a detection range of 5–10(6) cfu/mL and a detection limit of 3 cfu/mL in 20 min.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0950 https://doi.org/10.1007/s00604-017-2142-22017A magnetic relaxation switch aptasensor for the rapid detection of Pseudomonas aeruginosa using superparamagnetic nanoparticlesAptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellDevelop a magnetic relaxation switch (MRSw) aptasensor (SPIO-aptamer) for the determination of Pseudomonas aeruginosa in real food and drinking water samples.Exhibit a linear range from 10(0) cfu/mL to 10(6) cfu/mL, and a detection limit of 50 cfu/mL was obtained within 40 mins.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0978 275263402017Aptamer biosensor for Salmonella typhimurium detection based on luminescence energy transfer from Mn2+-doped NaYF4:Yb, Tm upconverting nanoparticles to gold nanorodsS. typhimurium aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellA LET method based on UCNPs and gold nanorods (Au NRs) was developed for the determination of Salmonella typhimurium.Linear range: 12 to 5×10^5 cfu/mL and Limit of Detection (LOD): 11 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_0980 286917952017Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureusS. aureus aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellA colorimetric method for the detection of S. aureus was developed using aptamer-modified Cu-MOF nanoparticles.The linear range for S. aureus detection is 50-10,000 CFU/mL, with a detection limit of 20 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1001 https://doi.org/10.1016/j.snb.2017.05.1462017A simple dendrimer-aptamer based microfluidic platform for E. coli O157:H7 detection and signal intensification by rolling circle amplificationAptamerATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Whole cellDeveloped a dendrimer-aptamer microfluidic detection system with Rolling circle amplification (RCA) for the detection of E. coli O157:H7 cells.RCA was able to enhance detection signals by up to 50 times, and the limit of detection of the system was reduced to 10(2) cells/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and 5'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1002 293574052018Combat biofilm by bacteriostatic aptamer-functionalized graphene oxideST-3 (or ST-33)CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG60N/AssDNASalmonella Typhimurium (S. Typhimurium)BiofilmAptamer-GO conjugate reduces the cellular membrane potential to inhibit biofilm formation.93.3 ± 3.4% inhibition ratio at the initial stage of biofilm formation and 84.6 ± 5.1% degradation ratio on formed biofilms.12N/AN/ATherapeuticsN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1021 290985172018Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilmsPA-ap1 (F23)CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellAptamer-ciprofloxacin-SWNTs complex for antibiofilm activity.90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation.16Flow Cytometry17.27 ± 5.00 nMTargeted Delivery/TherapeuticsWhole Cell-SELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1124 298706922018Carbon nanotube-based aptasensor for sensitive electrochemical detection of whole-cell SalmonellaSalmonella aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellDeveloped an amino-modified aptasensor using MWCNTs-deposited ITO electrode for the detection of Salmonella.It possesses a linear range from 10 mV/s to 90 mV /s, and the detection limit was 5.5 × 10(1) cfu/mL and 6.7 × 10(1) cfu/mL for S. Enteritidis and S. Typhimurium, respectively.N/AN/AN/ABiosensorN/AAmidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1136 301659342018Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. TyphimuriumS11GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGACAGATTAAAAGTGGTTGGGCAACTTCTGCTTGCGAA-AGATAGTAAGTGCAATCT1005'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3'ssDNASalmonella Typhimurium (S. Typhimurium) ( ATCC 19585)Whole cellIdentify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium.N/A10Surface Plasmon Resonance (SPR)4.41 × 10(-12) MDetectionWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_1182 299016742018Aptamer immobilization on amino-functionalized metal-organic frameworks: an ultrasensitive platform for the electrochemical diagnostic of Escherichia coli O157:H7E.coli aptamerCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7Whole cellElectrochemical biosensor based on amino-functionalized metal-organic frameworks (MOFs) for detection of Escherichia coli O157:H7.Display linear range of 2.1×10(1) to 2.1×10(7) CFU/mL with a LOQ of 21 CFU/mL and LOD of 2 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1188 288878142018Construction and application of an electrochemical biosensor based on an endotoxin aptamerEAQ2ATGAGAGCGTCGGTGTGGTATGCTCACCCCCTGCGGCGCCGTTACGCGGTCCTTGTGTAGGAGGGTGCGGAAGTA75N/AssDNAEscherichia Coli (E. Coli) 055:B5 (L2880)Lipopolysaccharide (LPS)An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin.N/AN/ABio-Layer Interferometry (BLI)32.5 nMBiosensorN/A5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1189 288878142018Construction and application of an electrochemical biosensor based on an endotoxin aptamerEAQ3ATGAGAGCGTCGGTGTGGTATCGCCGCGCTCGCCGATCGTTCCTCCCCCCCCGTCTGTAGGAGGGTGCGGAAGTA75N/AssDNAEscherichia Coli (E. Coli) 055:B5 (L2880)Lipopolysaccharide (LPS)An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin.Showed a low detection limit of 0.001 EU/mL and a linear range of 0.001–1 EU/mL.N/ABio-Layer Interferometry (BLI)22.9 nMBiosensorN/A5'-Amidation (NH₂) and 5'-BiotinylatedN/AThe biosensor maintained a steady EIS response value after 1 week of storage in the PBS (10 mM, pH 7.4) at 4°C, and the response value still occupied 90%.Best CandidateN/AN/A
ABdb_1232 https:doi.org10.1039C9AY01509D2019A nano-sized chitosan particle based electrochemical aptasensor for sensitive detection of P. aeruginosaP.aeruginosa aptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellDevelop an aptasensor based on a glassy carbon electrode (GCE) modified with nano-sized chitosan particles (NCs) for sensitive and simultaneous detection of P. aeruginosa.Displayed a low detection limit of 3 CFU/mL, wide linearity of 10(1)–10(7) CFU/mL and a recovery rate from 93.2% to 124%.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1233 https://doi.org/10.1021/acssuschemeng.9b013142019Development of a Sensitive Diagnostic Device Based on Zeolitic Imidazolate Frameworks-8 Using Ferrocene–Graphene Oxide as Electroactive Indicator for Pseudomonas aeruginosa DetectionP.aeruginosa aptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellAn electrochemical biosensor (Fc-GO/Apt/HZIFs-8/GCE ) based on aptamers immobilized in engineered zeolitic imidazolate Framework-8 (ZIFs-8) for the detection of P. aeruginosa in human urine samples.Exhibits a wide linear dynamic range (from 1.2 × 10(1) to 1.2 × 10(7) CFU/mL) with a low detection limit of 1 CFU/mL.N/AN/AN/ABiosensorWhole Cell-SELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1237 316558992019Impedimetric aptasensor for Pseudomonas aeruginosa by using a glassy carbon electrode modified with silver nanoparticlesP.aeruginosa aptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellDevelop an aptasensor based on an immobilised NH2-aptamer that was covalently attached to the AgNP/GCE surface for the detection of P. aeruginosa.The impedance increases on going from 10(2) to 10(7) CFU/mL concentrations of P. aeruginosa, and the detection limit is 33 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1279 316173472019Ultrasensitive Fluorometric Angling Determination of Staphylococcus aureus in Vitro and Fluorescence Imaging in Vivo Using Carbon Dots with Full-Color EmissionS. aureus aptamer (Apt)GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellAn ultrasensitive magnetic fluorescence aptasensor was designed using Fe3O4/CD for the separation and detection of S. aureus.The FRET-based aptasensor achieved a wide linear range of 50–10(7) CFU/mL and a detection limit of 8 CFU/mL.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1280 310361832019Rapid and label-free detection of Brucella melitensis in milk and milk products using an aptasensorB. melitensis aptamerGAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC38N/AssDNABrucella MelitensisWhole cellA QCM-aptasensor [Fe3O4 @SiO2 @p(PEG-MA-GMA)] was developed for the determination of B. melitensis from food samples.The detection limits of the QCM aptasensor were in the range 1.0(2)–1.0(7) CFU/mL, with recoveries up to 79% and LOD of 100 CFU/mL.15N/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1345 307974662019Aptamer surface functionalization of microfluidic devices using dendrimers as multi-handled templates and its application in sensitive detections of foodborne pathogenic bacteriaE. coli O157:H7 aptamerCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG42N/AssDNAEscherichia Coli (E. Coli) O157:H7Whole cellA microfluidic system using a dendrimer-aptamer modified surface was developed for sensitive detection of E. coli O157:H7.The G7-apatamer modified detection system achieved a low limit of detection of 10(2) cells/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1350 323331132020Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strainsSA20GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT45N/AssDNAStaphylococcus aureus (S. aureus) susceptible strains and MRSAWhole cellAptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic.MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively.N/AN/AN/ATargeted Delivery/TherapeuticsN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1383 322912462020Dual aptamer assay for detection of Acinetobacter baumannii on an electromagnetically-driven microfluidic platformAptamerACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC72N/AssDNAAcinetobacter BaumanniiWhole cellDual aptamer assay to diagnose AB by using an electromagnetically-driven microfluidic system.Within 30 minutes, a limit of detection of only 100 CFU/reaction and a range of 10^2 to 10^5 CFU/reaction was obtained.N/AN/A6.8 ± 1.9 nMBiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1384 329938652020A universal signal-on electrochemical assay for rapid on-site quantitation of vibrio parahaemolyticus using aptamer modified magnetic metal-organic framework and phenylboronic acid-ferrocene co-immobilized nanolabelAptamerTTTTTTTTTCAACGAAACAGTGACTCGTTG30N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellDeveloped a signal-on type electrochemical aptasensor (Fe3O4@NMOF-Apt) to rapidly and on-site detect V.P.Detects V.P in the range of 10–10(9) cfu/mL with an LOD of 3 cfu/mL and within only 20 min.N/ALinearized adsorption isotherm16.8 nM (with V.P.) and 2.2 ± 0.2 nM (with Fe3O4@NMOF-Apt)BiosensorN/A5'-Amidation (NH₂)N/ANo significant difference in the measured blank and signals was observed over 3 months with aptasensor, when 91.3% of the initial signal was obtained.N/AN/AN/A
ABdb_1385 329053292020Simple Colorimetric Assay for Vibrio parahaemolyticus Detection Using Aptamer-Functionalized NanoparticlesV.P. AptamerTCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT40N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellDeveloped a visual colorimetric assay using aptamer-conjugated MNPs and AuNPs for the detection of V. parahaemolyticus.Shows a linear range of 10-10(6) cfu/mL, with a limit of detection of 2.4 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) or ThiolatedN/AN/AN/AN/AN/A
ABdb_1437 325943192020SiC-functionalized fluorescent aptasensor for determination of Proteus mirabilisAptamerTTGCTGTAGGGGAGGAGGGTGGGT24N/AssDNAProteus Mirabilis (ATCC 12453)Whole cellDeveloped a fluorescent aptasensor based on aptamer-modified SiC quantum dots (DNA-SiC QDs) for the determination of Proteus mirabilis.The linear range is from 10(3) to 10(8) CFU/mL, and the limit of detection is 526 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1440 316550502020Rapid and sensitive detection of Salmonella with reduced graphene oxide-carbon nanotube based electrochemical aptasensorS. Typhimurium aptamerTATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium)Whole cellDevelop a biosensor using reduced graphene oxide-carbon nanotubes (rGO-CNT) nanocomposite via the hydrothermal method for label-free electrochemical detection of S. enterica.Display a wide linear dynamic range from 10(1) until 10(8) cfu/mL with a 10(1) cfu/mL of the limit of detection.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AssDNA/rGO-CNT/GCE aptasensor showed good to excellent stability when stored for 20 days in ultrapure water at 4°C.N/AN/AN/A
ABdb_1453 345676192020An aptamer-based shear horizontal surface acoustic wave biosensor with a CVD-grown single-layered graphene film for high-sensitivity detection of a label-free endotoxinAptamerCTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT86N/AssDNAEscherichia Coli (E. Coli) 055:B5 (L4524)Endotoxin (Lipopolysaccharide (LPS))Developed SH-SAW biosensor with chemical vapour deposition (CVD)-grown single-layered graphene (SLG) for endotoxin detection.The biosensor exhibited a linear detection range of 0-100 ng/mL and a detection limit (LOD) of 3.53 ng/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1454 332417942020Rapid and highly sensitive detection of Salmonella typhimurium in lettuce by using magnetic fluorescent nanoparticlesS. typhimurium aptamerAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Outer membrane protein (OMP)Develop a fluorescent sensor (FMNCs-Apt), based on Fe3O4 magnetic nanoparticles and aptamer-modified carbon quantum dots for the detection of S. typhimurium in lettuce.Detection limit (LOD) of 100 CFU/mL in vegetable washing solution and 138 CFU/mL in lettuce samples with a linear range of 10(3)-10(6) CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1486 321519092020Surface-enhanced Raman spectroscopic-based aptasensor for Shigella sonnei using a dual-functional metal complex-ligated gold nanoparticles dimerS. Sonnei aptamerTGAGCCCAAGCCCTGGTATGTTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCCGGCAGGTCTACTTTGGGATC80N/AssDNAShigella Sonnei (ATCC 51334)Whole cellDeveloped a SERS aptasensor using a composite material integrated with the Raman active 4-MBA ligand of the Eu-complex and citrate-stabilised Au nanoparticles (cit-Au NPs) for the detection of S. sonnei.Showed a good linear relationship in the range of 10–10(6) cfu/mL with a limit of detection (LOD) as low as 10 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1493 328001402020Developing a dual-RCA microfluidic platform for sensitive E. coli O157:H7 whole-cell detectionsAptamerATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT72N/AssDNAEscherichia Coli (E. Coli) O157:H7Lipopolysaccharide (LPS)Developed a dual-RCA microfluidic platform for sensitive detection of E. coli O157:H7 cells.Achieved a linear range of 10(2) - 10(5) cells/mL with the limit of detection of 80 cells/mL in both orange juice and milk, thereby increasing overall detection signal intensities by approximately 250 times.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) LabeledN/AN/AN/AN/AN/A
ABdb_1499 322008872020DNA aptamer-based non-faradaic impedance biosensor for detecting E. coliOMP Ag1 aptamerATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT73N/AssDNAEscherichia Coli (E. Coli) BL21 strainOuter membrane protein Ag1 (E. coli OMP Ag1)Developed an impedance-based biosensor using aptamer-functionalized Interdigitated Electrode (IDE) arrays to detect E. coli.Detection limit of 9 cfu/mL and linear concentration range of 25–1000 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1540 346649412021Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite SheetsS. Typhimurium aptamer (ST-NH2)TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG52N/AssDNASalmonella Typhimurium (S. Typhimurium) (CMCC 50115)Whole cellICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium.Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model.N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂)ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities.N/AN/AN/AN/A
ABdb_1544 340516012021Sensitive detection of S. Aureus using aptamer- and vancomycin -copper nanoclusters as dual recognition strategyAptamerGCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT45N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped an aptamer- and antibiotic-based dual detection sensor, combines copper nanoclusters (CuNCs) for the detection of S. aureus.Showed a linear range of 10(2)-10(8) CFU/mL, and a detection limit of 80 CFU/mL after 45 min.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1548 343960092021DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid KillingMRSA aptamerATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA755'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3'ssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Whole cellApt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation.Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2).N/AN/AN/ATargeted Delivery/TherapeuticsN/A3'-Amidation (NH₂) and 5'-FITC LabeledThe aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination.N/AN/AN/AN/A
ABdb_1551 330761472021Ratiometric fluorescence resonance energy transfer aptasensor for highly sensitive and selective detection of Acinetobacter baumannii bacteria in urine sample using carbon dots as optical nanoprobesAb aptamerCAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC71N/AssDNAAcinetobacter BaumanniiWhole cellDevelop an ingenious ratiometric fluorescent aptasensor for the detection of (Ab) bacteria based on FRET between ortho-phenylenediamine carbon dots (o-CD), nitrogen-doped carbon nanodots (NCND), and graphene oxide (GO).Display linear range from 2.0 × 10(3) to 4.5 × 10(7) cfu/mL and the low detection limit of 3.0 × 10(2) cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AAfter a storage period of 4 weeks, over 90% of the initial response remained of the aptasenosr.N/AN/AN/A
ABdb_1552 https://doi.org/10.1016/j.microc.2021.1063882021Rapid and sensitive determination of Pseudomonas aeruginosa by using a glassy carbon electrode modified with gold nanoparticles and aptamer-imprinted polydopamineAptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellDevelop an electrochemical sensor based on a combination of aptasensing and molecular imprinting employing GCE/AuNP/Aptamer-MIP for ultrasensitive detection of P. aeruginosa.Exhibited a wide linear dynamic concentration range of 10(1) to 10(7) CFU/ml with a low detection limit of 1 CFU/ml.N/AN/AN/ADetectionN/A5'-Amidation (NH₂)N/AThe GCE/AuNP/Aptamer-MIP aptasensor signal remained unchanged, and only a 3% decrease in the peak current occurred after 50 repetitive cycles.N/AN/AN/A
ABdb_1553 345787622021Aptasensor for the Detection of Mycobacterium tuberculosis in Sputum Utilising CFP10-ESAT6 Protein as a Selective BiomarkerAptamerGCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC90N/AssDNAMycobacterium Tuberculosis (M.Tb.)ESAT6/CFP10 fusion proteins (EC proteins)Developed a portable electrochemical aptamer-antibody-based sandwich biosensor via CapApt/GP/PANI-modified SPGE surface for M. tb. detection in clinical sputum samples.Detection of the CFP10-ESAT6 antigen ranged from 5 to 500 ng/mL, with a detection limit of 1.5 ng/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1569 334797972021A turn-on-type fluorescence resonance energy transfer aptasensor for vibrio detection using aptamer-modified polyhedral oligomeric silsesquioxane-perovskite quantum dots/Ti3C2 MXenes composite probesVP aptamerTTTTTTTTTCAACGAAACAGTGACTCGTTG30N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellDeveloped a turn-on–type aptasensor based on FRET pair using aptamer modified polyhedral oligomeric silsesquioxane-perovskite quantum dots (POSS-PQDs-Apt) as signal probe and titanium carbide (Ti3C2) MXenes as quencher for Vibrio parahaemolyticus (VP) determination.Under optimized conditions, the assay can determine VP in the concentration range 10(2) - 10(6) cfu/mL with the detection limit (LOD) of 30 cfu/mL and 100 cfu/mL by naked eye in aquaculture water.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1581 333031522021Hollow carbon nanocapsules-based nitrogen-doped carbon nanofibers with rosary-like structure as a high surface substrate for impedimetric detection of Pseudomonas aeruginosaAptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellDeveloped an electrochemical aptasensor based on hollow carbon nanocapsule-based nitrogen-doped carbon nanofibers (CNCNF) with a rosary-like structure for the detection of PA.The linear range and LOD of the aptasensor were 101-107 CFU/ml and 1 CFU/ml.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AAfter 8 days of storage in Fe(CN)6 3-/4- at 4°C, the electrode was found to be 89% of its initial activity.N/AN/AN/A
ABdb_1585 349707242021Colorimetric determination of Listeria monocytogenes using aptamer and urease dual-labeled magnetic nanoparticles and cucurbit[7]uril-mediated supramolecular assembly of gold nanoparticleAptamerTTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT57N/AssDNAListeria Monocytogenes (ATCC 19111)Whole cellDeveloped a colorimetric strategy using apt-MNP-urease conjugate for the detection of L. monocytogenes.Achieved a concentration range from 10 to 10(6) cfu/mL, and the visual determination can be done down to 10 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1596 344067472021Upconversion Nanoprobes Based on a Horseradish Peroxidase-Regulated Dual-Mode Strategy for the Ultrasensitive Detection of Staphylococcus aureus in MeatS. aureus aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped a colorimetric and fluorescent dual-mode nanoprobe using apt-MNPs and HRP-UCNPs-cDNA for the detection of S. aureus.Obtained limits of detection of 22 CFU/mL for fluorescence and 20 CFU/mL for colorimetry in a linear range of 56–5.6 × 10(6) CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1597 https://doi.org/10.1007/s13738-021-02384-92021Rapid and sensitive detection of Escherichia coli O157:H7 based on silver nanocluster fluorescent probeE. coli O157:H7 aptamerTGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC80N/AssDNAEscherichia Coli (E. Coli) O157:H7Whole cellDetection of E. coli O157:H7 in food based on aptamer-modified silver nanocluster fluorescent probes.The linear range was 10–10(6) CFU/mL, and the detection limit was 0.2549 CFU/mL in the buffer and 0.6031 CFU/mL in the milk simulation sample.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1606 https://doi.org/10.1016/j.snb.2020.1291002021Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticlesE8TAGGGAAGAGAAGGACATATGA-CATTCTGCACCGCCATCAGTCTTTCTTCGATACCGCGTTT-TTGACTAGTACATGACCACTTGA855'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3'ssDNAEscherichia Coli (E. Coli) (MTCC no.1698)Whole cellIdentify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation.The limit of detection observed visually was 10(2) cells/mL with GO coating and 10(3) cells/mL without GO. The detection limit in real-time coconut water samples was also 10(2) cells/mL.7Fluorescence Microplate Reader (Fluorescence Spectroscopy)15.90 ± 3.07 nMBiosensorWhole Cell-SELEX5'-FAM Labeled, 5'-Thiolated and 5'-Amidation (NH₂)N/AN/ABest CandidateN/AN/A
ABdb_1653 352003472022Paper-Based Electrodes Conjugated with Tungsten Disulfide Nanostructure and Aptamer for Impedimetric Detection of Listeria monocytogenesAptamerATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT47N/AssDNAListeria MonocytogenesWhole cellDeveloped an aptasensor based on ePAD that employs a tungsten disulfide (WS2)/aptamer hybrid for the detection of L. monocytogenes.The limit of detection (LoD) was 10 CFU/mL, with a linear range of 10(1)-10(8) CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AAptasensor gives a stable impedance response over a period of 15 days.N/AN/AN/A
ABdb_1671 343290202022Targeted mesoporous silica nanoparticles for improved inhibition of disinfectant resistant Listeria monocytogenes and lower environmental pollutionA15-HP-AmTACTATCGCGGAGACAGCGCGGGAGGCACCGGGGATAGTA40N/AssDNAListeria Monocytogenes (ATCC 19115 and ATCC 7644)Whole cellBAC-encapsulated, aptamer-functionalized silica nanoparticles (AptBACNP) effectively killed only the target bacterium, L. monocytogenes, at lower doses, but not other bacteria.Inhibition (MIC value) of BAC resistant Listeria strains with 8 times less the usual disinfectant dose.N/AN/AN/ATherapeuticsN/A5'-Amidation (NH₂)MSNPs are slightly cytotoxic to erythrocytes and MCF-7 cells at concentrations more than 25 µg/ml.N/AN/AN/AN/A
ABdb_1672 358504612022Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destructionAptamerTAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA86N/AssDNAEnterococcus FaecalisWhole cellApt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity.aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM).N/AN/AN/ATargeted Delivery/TherapeuticsN/A5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1713 363545052022Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis DiagnosisMPT64 aptamerTTTTTTTTTTGGGAGCTGATGTCGCATGGGTTTTGATCACATGA44N/AssDNAMycobacterium Tuberculosis (M.Tb.)MPT64 proteinAmperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB.Achieved a detection limit of 1.82 ng/mL and a linear range of 0.75–250 ng/mL for MPT64 antigen within 2.5 h.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1714 363545052022Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis DiagnosisCFP10 aptamerN/AN/AN/AN/AMycobacterium Tuberculosis (M.Tb.)CFP10 antigenAmperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB.Achieved a detection limit of 1.68 ng/mL and a linear range of 0.5–100 ng/mL for CFP10 antigen within 2.5 h.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1720 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB46GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.LOD value as low as 27 ± 11 cells.15Fluorescence Binding Assay616 ± 13 cells/mlBiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1721 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB48GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1722 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB70GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells.15Fluorescence Binding Assay632 ± 132 cells/mlBiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_1723 348099852022Surface plasmon resonance aptasensor for Brucella detection in milkB72GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC735'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3'ssDNABrucella MelitensisWhole cellDeveloped a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples.N/A15Fluorescence Binding AssayN/ABiosensorWhole Cell-SELEX5'-Amidation (NH₂) and 5'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_1724 352709992022Detection of E. coli Bacteria in Milk by an Acoustic Wave Aptasensor with an Anti-Fouling CoatingAptamerATCCGTCACACCTGCTCTACGGCGCTCCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT74N/AssDNAEscherichia Coli (E. Coli) DH5αWhole cellDeveloped an electromagnetic piezoelectric acoustic sensor device (EMPAS) based on SiO2-MEG-NH2-Aptamer for the detection of E.coli. in milk samples.Selective measurement of E. coli in PBS and in cow’s milk samples down to limits of detection of 35 and 8 CFU/mL, respectively, with a linear range of 10–10(7) CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1741 348029262022Rapid and selective detection of Bacillus cereus in food using cDNA-based up-conversion fluorescence spectrum copy and aptamer modified magnetic separationAptamerAGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA73N/AssDNABacillus CereusWhole cellDeveloped an aptansensor for Bacillus cereus detection based on up-conversion and magnetic nanomaterials (UCNPs-cDNA-Apt-MNPs complex).Display a linear range of 49-49 × 10(6) cfu/mL under the optimal conditions with a detection limit of 22 cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1743 361920572022Aptamer-based colorimetric detection of methicillin-resistant Staphylococcus aureus by using a CRISPR/Cas12a system and recombinase polymerase amplificationAptamer 2CCTCCCTCCCTCCCTTTTTCCCACCCACCCACC33N/AssDNAMethicillin-resistant Staphylococcus aureus (MRSA)Whole cellDeveloped an aptamer-based colorimetry sensor using a CRISPR/Cas12a system and recombinase polymerase amplification (RPA) for sensitive detection of MRSA.MRSA was detected as low as 8 CFU/mL and can be quantified with a linear range of 10 CFU/mL to 10(5) CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1745 https://doi.org/10.1016/j.snb.2021.1308392022A dual-mode aptasensor for foodborne pathogens detection using Pt, phenylboric acid and ferrocene modified Ti3C2 MXenes nanoprobeV.P-AptTTTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA38N/AssDNAVibrio Parahaemolyticus (ATCC 17802)Whole cellDeveloped a dual-mode aptasensor based on electrochemical and colorimetric modes using PBA-Fc@Pt@MXenes nanoprobe for the detection of V.P in shrimps.Showed a LOD and linear range of 5 CFU/mL and 10(1) to 10 (8) CFU/mL by electrochemical mode and 30 CFU/mL and 10(2) to 10 (8) CFU/mL by coulometric mode.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AThe electrochemical signal retained 89.6% of its original value after 2 weeks.N/AN/AN/A
ABdb_1782 365492132023Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tagsApt1GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAEscherichia Coli (E. Coli) (ATCC 25922)Whole cellA SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus.The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) or 5'-ThiolatedN/AN/AN/AN/AN/A
ABdb_1783 365492132023Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tagsApt2GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (CMCC 26003)Whole cellA SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus.The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂) or 5'-ThiolatedN/AN/AN/AN/AN/A
ABdb_1809 376199022023Development of a label-free impedimetric aptasensor for the detection of Acinetobacter baumannii bacteriaAptamerACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC72N/AssDNAAcinetobacter Baumannii (ATCC 19606)Whole cellAn electrochemical aptasensor was developed using an aptamer immobilized on the surface of a CSPE modified with the nanocomposite Fe3O4@SiO2@Glyoxal (Gly) for A. baumannii detection.Specifically detect A. baumannii in the concentration range from 1.0 × 10(3)–1.0 × 10(8) CFU/mL and with a detection limit of 150 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AThe current response from 0 day to 28 days was 94.3%, 90%, and 86.5% of the primary Rct response of the aptasensor remained at 4°C after 14, 21 and 28 days, respectively.N/AN/AN/A
ABdb_1816 364936742023Sandwich-Type Electrochemical Aptasensor for Highly Sensitive and Selective Detection of Pseudomonas Aeruginosa Bacteria Using a Dual Signal Amplification StrategyF23CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 15442)Whole cellDeveloped a sandwich-type electrochemical aptasensor using a carbon screen-printed electrode (MIL101(Cr)/MWCNT) and AgNPs/C-g-C3N4/Apt for P. aeruginosa detection.Display a limit of detection of 1 CFU/mL and a linear range of 10 to 10(7) CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AThe DPV current intensity of the aptasensor for 10(5) CFU/mL of P. aeruginosa was approximately 92.4% of its initial signals after 21 days stored at 4°C.N/AN/AN/A
ABdb_1828 374666982023A signal-off aptasensor for the determination of Acinetobacter baumannii by using methylene blue as an electrochemical probeAptACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC72N/AssDNAAcinetobacter Baumannii (ATCC 19606)Whole cellDeveloped an electrochemical aptasensor with Apt/MWCNT@Fe3O4@SiO2-Cl/CSPE nanocomposite to detect A. baumannii.Display a linear range of 10.0–1.0 × 10(7) CFU/mL and a detection limit of 1 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AThe current density of the aptasensor for 10(5) CFU/mL of A. baumannii was approximately 92.3% of its initial signals after 21 days.N/AN/AN/A
ABdb_1838 https://doi.org/10.1002/adfm.2024034402024Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of PseudomonasF23CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellDeveloped an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa.The LOD for the aptamer-modified membrane P-F23 was 1.42 × 10(6) CFU/cm^2.N/AN/AN/ABiosensorN/AAmidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1839 https://doi.org/10.1002/adfm.2024034402024Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of PseudomonasSt21Lp17AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT38N/AssDNAPseudomonas Aeruginosa (ATCC 27853)Whole cellDeveloped an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa.The LOD for the aptamer-modified membrane P-St21Lp17 was 4.46 × 10(6) CFU/cm^2.N/AN/AN/ABiosensorN/AAmidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1842 395332982024Rapid detection of Brucella cells using a gold nanoparticle-based aptasensor via a simple colorimetric methodB. melitensis-specific aptamerGAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC38N/AssDNABrucella Melitensis strain Rev. 1 vaccine and Brucella Abortus strain RB51 vaccineWhole cellDetection of Brucella cells using a biosensor, based on gold nanoparticles (GNPs) and a specific aptamer, via a colorimetric reaction.Able to detect 1.5 × 10(1) CFU/mL with a linear range of 1.5 × 10(1)-1.5 × 10(8) CFU/mL of the bacterial cells.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1904 405175692025Ultrasensitive electrochemical aptasensor for Pseudomonas aeruginosa detection using N-doped MWCNTs/AgNPs nanocompositeF23CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellDeveloped an electrochemical P.A. biosensor based on N-MWCNTs/AgNPs-10/Apt for the detection of P. aeruginosa.Exhibited a wide linear detection range from 10(-1) to 10(6) CFU/mL, and the limit of detection is 0.0798 CFU/mL.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1921 400531472025Fluorescent aptasensor for detection of Salmonella typhimurium using boric acid-functionalized terbium metal-organic framework and magnetic nanoparticlesAptamerTAGGGAAGAGAAGGACATATGATCAGGAGTCATGCTACCACTGGTGATTACGCCTCGCTCAGCTTGACTAGTACATGACCACTTGA86N/AssDNASalmonella Typhimurium (S. Typhimurium) (MTCC 3232)Whole cellA fluorescent detection platform was developed using boric acid-functionalized terbium metal–organic framework (BA-Tb-MOF) and carboxyl-modified magnetic nanoparticles (MNPs) to identify S. typhimurium.Showed an inverse linear relationship within the range of 10(1)–10(9) CFU/mL, and the detection limit was 4 CFU/mL.N/AN/AN/ABiosensorWhole Cell-SELEX5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1926 401369432025Nanoparticle-Enhanced Acoustic Wave Biosensor Detection of Pseudomonas aeruginosa in FoodP. aeruginosa aptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa PAO1Whole cellDeveloped a biosensor for detecting P. aeruginosa in whole milk samples using an aptamer functionalized antifouling linking molecule 3-(2-mercaptoethanoxy)propanoic acid (HS-MEG-COOH), and another one with the addition of AuNPs.Exhibited a linear range 10(2)-10(5) CFU/mL and limit of detection (LOD) of 86 CFU/mL in PBS and 157 CFU/mL in milk, and with AuNPs, reducing the extrapolated LOD to 68 CFU/mL in PBS and 46 CFU/mL in milk.N/AN/AN/ABiosensorN/A3'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_1945 413440102026SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureusApt1 & Apt3ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT81N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus.The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli.N/AN/AN/ABiosensorN/A5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4)N/AN/AN/AN/AN/A
ABdb_1946 413440102026SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureusApt2 & Apt4TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT71N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus.The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus.N/AN/AN/ABiosensorN/A5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4)N/AN/AN/AN/AN/A
ABdb_1950 411351622026Silver-decorated nanobeads for high-performance and flexible analysis of Shigella dysenteriae utilizing a paper-based aptasensorAptamerATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGCAGGGATTAGTCAAGAGGTAGACGCACATA86N/AssDNAShigella DysenteriaeWhole cellDeveloped an Ag/MBs-modified paper-based aptasensor to detect S. dysenteriae.MB-based assays achieve broad linearity (DPV = 10(2)–10(8) CFU/mL, EIS = 10(1)–10(9) CFU/mL) and high sensitivity (DPV = 90 CFU/mL, EIS = 8.09 CFU/mL).N/AN/AN/ABiosensorN/A5'-Amidation (NH₂)N/ALong stability of up to 28 days at 4°C.N/AN/AN/A
ABdb_1957 190528512009Plastic-adherent DNA aptamer-magnetic bead and quantum dot sandwich assay for Campylobacter detectionC2 and C3N/AN/AN/AssDNACampylobacter Jejuni (ATCC 29428)Surface proteinIdentify aptamers against surface proteins from C. jejuni and develop a sandwich assay ( (C2 aptamer-MB-bacteria-C3 aptamer-QD complexes) for its detection.Exhibits detection limits as low as an average of 2.5 cfu equivalents in buffer and 10–250 cfu in various food matrices.5N/AN/ABiosensorSELEX5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_2124 343991932021Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pyloriHp-1N/AN/A5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'ssDNAHelicobacter Pylori (ATCC 700392)Whole cellAptamer-modified superparamagnetic nanoparticles (SPMNPs) are used to develop a triple-module biosensor to capture H. pylori.Exhibited a wide detection range of 10-10(7) CFU/mL and a limit of detection (LOD) as low as 1 CFU/mL.10Fluorescence Spectroscopy36.91 ± 11.1 nMBiosensorSELEX5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/ABest CandidateN/AN/A
ABdb_2125 343991932021Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pyloriHp-2N/AN/A5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'ssDNAHelicobacter Pylori (ATCC 700392)Whole cellAptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori.N/A10Fluorescence Spectroscopy46.31 ± 11.31 nMBiosensorSELEX5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_2126 343991932021Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pyloriHp-3N/AN/A5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'ssDNAHelicobacter Pylori (ATCC 700392)Whole cellAptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori.N/A10Fluorescence Spectroscopy60.76 ± 11.69 nMBiosensorSELEX5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_2127 343991932021Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pyloriHp-4N/AN/A5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'ssDNAHelicobacter Pylori (ATCC 700392)Whole cellAptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori.N/A10Fluorescence Spectroscopy41.57 ± 16.18 nMBiosensorSELEX5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/AN/AN/AN/A
ABdb_2128 343991932021Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pyloriHp-5N/AN/A5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3'ssDNAHelicobacter Pylori (ATCC 700392)Whole cellAptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori.N/A10Fluorescence Spectroscopy67.74 ± 10.24 nMBiosensorSELEX5'-FAM Labeled and 5'-Amidation (NH₂)N/AN/AN/AN/AN/A