Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 111
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0054 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2F | CATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0055 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5R | GATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0056 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2R | GATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0057 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5F | CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC | 61 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0143 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E17F-72 | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0144 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E17F-37 | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0145 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E18R-72 | ATACGGGAGCCAACACCATTCTATCGTTCCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGGAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0146 | 23145045 | 2012 | An aptamer-based biosensor for colorimetric detection of Escherichia coli O157:H7 | E18R-42 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Develop a colorimetric aptasensor employing PDA vesicles for the determination of E. coli O157:H7. | Could detect cellular concentrations in a range of 10^4 to 10^8 CFU/ml within 2 hours with a detection limit of 10(4) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0336 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt1 | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-modified QDs (QD-apt) were developed to selectively capture and simultaneously detect the target bacteria. | For V. parahaemolyticus cells, a linear range of 3.4 × 10(4) to 3.4 × 10(7) cfu/mL was obtained with QD 535-apt 1-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0337 | 24267076 | 2013 | A dual-color flow cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and Salmonella typhimurium using aptamer conjugated quantum dots as labels | Apt2 | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified Quantum Dots (QD-apt) were developed for selective bacterial capture. | For S. typhimurium, a linear range obtained between the concentrations 3.8 × 10(4) to 3.8 × 10(7) cfu/mL was obtained with QD 585-apt 2-FCM, and a detection limit of 5 × 10³ cfu/mL was achieved. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0427 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 12.4 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0428 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 25.2 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0429 | 24280049 | 2014 | Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) (KCTC 2571) | Surface protein | Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection. | In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer). | N/A | N/A | 14.2 nM | Biosensor | N/A | 5'-FAM Labeled and 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0430 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₁ | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 25 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0431 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₂ | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 10 cfu/mL for V. parahemolyticus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0432 | 24568625 | 2014 | Simultaneous aptasensor for multiplex pathogenic bacteria detection based on multicolor upconversion nanoparticles labels | Apt₃ | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a multiplex method for the simultaneous detection of three pathogenic bacteria using multicolour upconversion nanoparticles (UCNPs) coupled with aptamers. | The linear range showed from 50-10(6) cfu/mL, and the limits of detection were 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0461 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt1 ( V. parahaemolyticus aptamer) | ATAGGAGTCACGACGACCAGAATCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACTTATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 25 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0462 | https://doi.org/10.1007/s00604-014-1406-3 | 2014 | Simultaneous detection of pathogenic bacteria using an aptamer based biosensor and dual fluorescence resonance energy transfer from quantum dots to carbon nanoparticles. | Apt2 (S. typhimurium aptamer) | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 14028) | Whole cell | Develop a dual fluorescence resonance energy transfer (FRET) from gQDs and rQDs and amorphous carbon nanoparticles (CNPs) for simultaneous detection of V. parahaemolyticus and S. typhimurium. | LOD: 35 cfu/mL and linear range from 50 to 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0500 | 25016253 | 2014 | Evanescent wave DNA-aptamer biosensor based on long period gratings for the specific recognition of E. coli outer membrane proteins | Aptamer | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | A label-free remote evanescent wave fibre optic sensor using long-period gratings (LPGs) was developed for the detection of EcOMPs. | Displayed linear responses in the range of 0.1 nM to 10 nM EcOMPs and LOD of 10 nM in less than 1 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0538 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A11 | ATACCAGCTTATTCAATT-TAGGCGGTGGAGATAGTAAGTGCAATCTAGGCGGTGGAGATAGTAAGTGCAATCTATGCC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | Inhibited SEB-mediated PBMC proliferation of 93% and TNF-α, IL-1β, IL-6, IL-2, and IFN-γ in culture supernatants were reduced by 77, 97, 64, 96, and 99%, respectively. 90% survival of mouse models of SEB-induced TSS. | 11 | Fluorescence Spectroscopy | 64 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FITC Labeled | Showed no cytotoxic effects on PBMCs. | N/A | N/A | N/A | N/A |
| ABdb_0552 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12 | UGUAAUUCUGCCAUUCUUUUUGGGGCGGAAUACAGGAUGU | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | fmA12-functionalized AgNPs resulted in specific S. aureus antimicrobial activity with only a 1.6 ± 1.0% survival of 12598 cells and 51.9 ± 2.0% survival of 10832 cells. | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 95 nM (by SPR) and 67.1 ± 6.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | 76% fmA12 survives in 10% mouse serum at 37°C over 24 h, and in 50% serum, 85.0% fmA12 survives after 5 h. | N/A | ~52 h for fmA12. | N/A |
| ABdb_0553 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmF07 | AUACGCUGCUCACUAAAGUCGGGAGUACUCCAAUGUUUUC | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 38.9 ± 4.1 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0554 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmE09 | AUCUAGCAAGCACUUGCAAACAUUCGAUAACGGGGAUUC | 39 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 418 ± 112 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0555 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmG12 | UGCCAAUGUAACUCAACACUCUUCAUUGAGCUGUCGGGCA | 40 | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Surface Plasmon Resonance (SPR) and Bio-Layer Interferometry (BLI) | 475 nM (by SPR) and 220 ± 24 nM (by BLI) | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0556 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ3 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.7 ± 3.5 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0557 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ6 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 63.1 ± 7.3 μM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0558 | 25443790 | 2015 | Highly stable aptamers selected from a 2'-fully modified fGmH RNA library for targeting biomaterials | fmA12Δ9 | N/A | N/A | 5'-TAATACGACTCACTATAGGGAGAGAACAATGACCTG-N40-GAGTGCATTGCATCACGTCAGTAG-3' | ssRNA | Staphylococcus aureus (S. aureus) | Staphylococcus aureus Protein A (SpA) | Identify 2′-fully modified aptamers against SpA and deliver aggregation-prone silver nanoparticles (AgNPs) to S. aureus for SpA-dependent cell killing. | N/A | 8 | Bio-Layer Interferometry (BLI) | 69.1 ± 16.7 nM | Targeted Delivery/Therapeutics | SELEX | 2'-O-methyl and 2'-Fluoro pyrimidines (2′-F-dGTP and 2′-OMe-dATP/dCTP/dUTP); 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0654 | 25590973 | 2015 | Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes | LMCA2 | ATACCAGCTTATTCAATT-CCAAAAGCGCACCCATATATGTTCTATGTCCCCCACCTCG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATTGCACTTACTATCT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Listeriolysin O (LLO) protein | Developed an aptamer-based sandwich assay (ABSA) platform to distinguish L. monocytogenes from other Listeria species and other bacterial genera. | Exhibited a linear response from 20 to 2×106 CFU per mL with a LOD of 20 CFU/mL. | 10 | Surface Plasmon Resonance (SPR) | 2.01×10(-12) M | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0675 | https://doi.org/10.1007/s00604-015-1649-7 | 2015 | Impedimetric Salmonella aptasensor using a glassy carbon electrode modified with an electrodeposited composite consisting of reduced graphene oxide and carbon nanotubes | Anti-Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Develop a label-free impedimetric aptasensor based on an amino-modified aptamer bound to rGO-MWCNT composite for the detection of Salmonella. | Exhibits a linear range from 75 to 7.5 × 10(5) cfu/mL and a detection limit of 25 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0756 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S3 | ATACCAGCTTATTCAATT-CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84% and reduced IFN-γ, TNF-α, IL-2, and IL-6 secretions by 89%, 87%, 73%, 69%, respectively. PEGS3 allowed 79% of the mice to survive the lethal challenge. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 36.93 ± 7.29 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0773 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E1 | GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Composite (TiO2-Apc) for enhanced photodynamic inactivation of target-specific bacteria. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 12.4 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0774 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E2 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 25.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0775 | 27427891 | 2016 | An aptamer cocktail-functionalized photocatalyst with enhanced antibacterial efficiency towards target bacteria | E10 | GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA | 90 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Enhanced photodynamic inactivation via aptamer-functionalized TiO₂ particles. | TiO₂-Apc particles killed approximately 80% of E. coli after 15 min, whereas the raw TiO₂ particles killed only 20% and the TiO₂-Aps particles killed 60% of E. coli after 15 min of UV irradiation. | N/A | Fluorescence Spectroscopy | 14.2 nM | Therapeutics | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0805 | 27318566 | 2016 | Staphylococcus aureus detection in blood samples by silica nanoparticle-oligonucleotides conjugates | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-functionalized silica magnetic nanoparticles-based assay for on-site determination of S. aureus. | Detects S. aureus cells as low as 682 CFU in whole blood, with a linear range from 800 CFU/ml blood to 104 CFU/ml blood. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0808 | 26894987 | 2016 | Diazonium-based impedimetric aptasensor for the rapid label-free detection of Salmonella typhimurium in food sample | Aptamer (N45) | TTTGGTCCTTGTCTTATGTCCAGAATGCGAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAAATTTCTCCTACTGGGATAGGTGGATTAT | 96 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | Developed a label-free impedimetric aptamer-based biosensor for S. typhimurium detection. | Rapid (30 min) detection with a concentration range of 1×10(1) to 1×10(8) CFU/mL and limit of detection (LOD) of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0823 | 28069377 | 2017 | Development of an aptamer-ampicillin conjugate for treating biofilms | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGACAACAGCGTGTAGTATCAGCTTACGGTG-TTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Salmonella Choleraesuis | Flagella | Aptamer-ampicillin conjugate (Apt3-Amp) to inhibit biofilm formation. | Biofilms containing the conjugate had the lowest survival ratio (37.22 ± 1.12%) compared with control conjugates. | 14 | Fluorescence Spectroscopy | 41 ± 2 nM | Therapeutics | Whole Cell-SELEX | 3'-Amidation (NH₂) and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0898 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-4 | ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 15.89 ± 1.77 nM | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0934 | 27825886 | 2017 | Upconversion nanoparticles based FRET aptasensor for rapid and ultrasenstive bacteria detection | E.coli aptamer | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 8739) | Whole cell | Upconversion nanoparticles (UCNPs) based FRET aptasensor (UCNPs-cDNA from AuNPs-aptamers) for detecting E. coli in tap/pond water and milk. | Display a detection range of 5–10(6) cfu/mL and a detection limit of 3 cfu/mL in 20 min. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0950 | https://doi.org/10.1007/s00604-017-2142-2 | 2017 | A magnetic relaxation switch aptasensor for the rapid detection of Pseudomonas aeruginosa using superparamagnetic nanoparticles | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Develop a magnetic relaxation switch (MRSw) aptasensor (SPIO-aptamer) for the determination of Pseudomonas aeruginosa in real food and drinking water samples. | Exhibit a linear range from 10(0) cfu/mL to 10(6) cfu/mL, and a detection limit of 50 cfu/mL was obtained within 40 mins. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0978 | 27526340 | 2017 | Aptamer biosensor for Salmonella typhimurium detection based on luminescence energy transfer from Mn2+-doped NaYF4:Yb, Tm upconverting nanoparticles to gold nanorods | S. typhimurium aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A LET method based on UCNPs and gold nanorods (Au NRs) was developed for the determination of Salmonella typhimurium. | Linear range: 12 to 5×10^5 cfu/mL and Limit of Detection (LOD): 11 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0980 | 28691795 | 2017 | Copper-Based Metal-Organic Framework Nanoparticles with Peroxidase-Like Activity for Sensitive Colorimetric Detection of Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A colorimetric method for the detection of S. aureus was developed using aptamer-modified Cu-MOF nanoparticles. | The linear range for S. aureus detection is 50-10,000 CFU/mL, with a detection limit of 20 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1001 | https://doi.org/10.1016/j.snb.2017.05.146 | 2017 | A simple dendrimer-aptamer based microfluidic platform for E. coli O157:H7 detection and signal intensification by rolling circle amplification | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a dendrimer-aptamer microfluidic detection system with Rolling circle amplification (RCA) for the detection of E. coli O157:H7 cells. | RCA was able to enhance detection signals by up to 50 times, and the limit of detection of the system was reduced to 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1002 | 29357405 | 2018 | Combat biofilm by bacteriostatic aptamer-functionalized graphene oxide | ST-3 (or ST-33) | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Biofilm | Aptamer-GO conjugate reduces the cellular membrane potential to inhibit biofilm formation. | 93.3 ± 3.4% inhibition ratio at the initial stage of biofilm formation and 84.6 ± 5.1% degradation ratio on formed biofilms. | 12 | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1021 | 29098517 | 2018 | Influence of aptamer-targeted antibiofilm agents for treatment of Pseudomonas aeruginosa biofilms | PA-ap1 (F23) | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Aptamer-ciprofloxacin-SWNTs complex for antibiofilm activity. | 90% inhibitory efficiency of complex aptamer-ciprofloxacin-SWNTs on biofilm formation. | 16 | Flow Cytometry | 17.27 ± 5.00 nM | Targeted Delivery/Therapeutics | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1124 | 29870692 | 2018 | Carbon nanotube-based aptasensor for sensitive electrochemical detection of whole-cell Salmonella | Salmonella aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an amino-modified aptasensor using MWCNTs-deposited ITO electrode for the detection of Salmonella. | It possesses a linear range from 10 mV/s to 90 mV /s, and the detection limit was 5.5 × 10(1) cfu/mL and 6.7 × 10(1) cfu/mL for S. Enteritidis and S. Typhimurium, respectively. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1136 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S11 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGACAGATTAAAAGTGGTTGGGCAACTTCTGCTTGCGAA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 4.41 × 10(-12) M | Detection | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1182 | 29901674 | 2018 | Aptamer immobilization on amino-functionalized metal-organic frameworks: an ultrasensitive platform for the electrochemical diagnostic of Escherichia coli O157:H7 | E.coli aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Electrochemical biosensor based on amino-functionalized metal-organic frameworks (MOFs) for detection of Escherichia coli O157:H7. | Display linear range of 2.1×10(1) to 2.1×10(7) CFU/mL with a LOQ of 21 CFU/mL and LOD of 2 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1188 | 28887814 | 2018 | Construction and application of an electrochemical biosensor based on an endotoxin aptamer | EAQ2 | ATGAGAGCGTCGGTGTGGTATGCTCACCCCCTGCGGCGCCGTTACGCGGTCCTTGTGTAGGAGGGTGCGGAAGTA | 75 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L2880) | Lipopolysaccharide (LPS) | An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin. | N/A | N/A | Bio-Layer Interferometry (BLI) | 32.5 nM | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1189 | 28887814 | 2018 | Construction and application of an electrochemical biosensor based on an endotoxin aptamer | EAQ3 | ATGAGAGCGTCGGTGTGGTATCGCCGCGCTCGCCGATCGTTCCTCCCCCCCCGTCTGTAGGAGGGTGCGGAAGTA | 75 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L2880) | Lipopolysaccharide (LPS) | An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin. | Showed a low detection limit of 0.001 EU/mL and a linear range of 0.001–1 EU/mL. | N/A | Bio-Layer Interferometry (BLI) | 22.9 nM | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | The biosensor maintained a steady EIS response value after 1 week of storage in the PBS (10 mM, pH 7.4) at 4°C, and the response value still occupied 90%. | Best Candidate | N/A | N/A |
| ABdb_1232 | https:doi.org10.1039C9AY01509D | 2019 | A nano-sized chitosan particle based electrochemical aptasensor for sensitive detection of P. aeruginosa | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on a glassy carbon electrode (GCE) modified with nano-sized chitosan particles (NCs) for sensitive and simultaneous detection of P. aeruginosa. | Displayed a low detection limit of 3 CFU/mL, wide linearity of 10(1)–10(7) CFU/mL and a recovery rate from 93.2% to 124%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1233 | https://doi.org/10.1021/acssuschemeng.9b01314 | 2019 | Development of a Sensitive Diagnostic Device Based on Zeolitic Imidazolate Frameworks-8 Using Ferrocene–Graphene Oxide as Electroactive Indicator for Pseudomonas aeruginosa Detection | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | An electrochemical biosensor (Fc-GO/Apt/HZIFs-8/GCE ) based on aptamers immobilized in engineered zeolitic imidazolate Framework-8 (ZIFs-8) for the detection of P. aeruginosa in human urine samples. | Exhibits a wide linear dynamic range (from 1.2 × 10(1) to 1.2 × 10(7) CFU/mL) with a low detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1237 | 31655899 | 2019 | Impedimetric aptasensor for Pseudomonas aeruginosa by using a glassy carbon electrode modified with silver nanoparticles | P.aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an aptasensor based on an immobilised NH2-aptamer that was covalently attached to the AgNP/GCE surface for the detection of P. aeruginosa. | The impedance increases on going from 10(2) to 10(7) CFU/mL concentrations of P. aeruginosa, and the detection limit is 33 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1279 | 31617347 | 2019 | Ultrasensitive Fluorometric Angling Determination of Staphylococcus aureus in Vitro and Fluorescence Imaging in Vivo Using Carbon Dots with Full-Color Emission | S. aureus aptamer (Apt) | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | An ultrasensitive magnetic fluorescence aptasensor was designed using Fe3O4/CD for the separation and detection of S. aureus. | The FRET-based aptasensor achieved a wide linear range of 50–10(7) CFU/mL and a detection limit of 8 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1280 | 31036183 | 2019 | Rapid and label-free detection of Brucella melitensis in milk and milk products using an aptasensor | B. melitensis aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis | Whole cell | A QCM-aptasensor [Fe3O4 @SiO2 @p(PEG-MA-GMA)] was developed for the determination of B. melitensis from food samples. | The detection limits of the QCM aptasensor were in the range 1.0(2)–1.0(7) CFU/mL, with recoveries up to 79% and LOD of 100 CFU/mL. | 15 | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1345 | 30797466 | 2019 | Aptamer surface functionalization of microfluidic devices using dendrimers as multi-handled templates and its application in sensitive detections of foodborne pathogenic bacteria | E. coli O157:H7 aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | A microfluidic system using a dendrimer-aptamer modified surface was developed for sensitive detection of E. coli O157:H7. | The G7-apatamer modified detection system achieved a low limit of detection of 10(2) cells/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1350 | 32333113 | 2020 | Inhibitory effects of aptamer targeted teicoplanin encapsulated PLGA nanoparticles for Staphylococcus aureus strains | SA20 | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) susceptible strains and MRSA | Whole cell | Aptamer-PLGA nanoparticles (Apt-teicoplanin-PLGA NPs) for the delivery of teicoplanin antibiotic. | MICs of teicoplanin decreased by 32- and 64-fold for susceptible strains and MRSA strains, respectively. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1383 | 32291246 | 2020 | Dual aptamer assay for detection of Acinetobacter baumannii on an electromagnetically-driven microfluidic platform | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Dual aptamer assay to diagnose AB by using an electromagnetically-driven microfluidic system. | Within 30 minutes, a limit of detection of only 100 CFU/reaction and a range of 10^2 to 10^5 CFU/reaction was obtained. | N/A | N/A | 6.8 ± 1.9 nM | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1384 | 32993865 | 2020 | A universal signal-on electrochemical assay for rapid on-site quantitation of vibrio parahaemolyticus using aptamer modified magnetic metal-organic framework and phenylboronic acid-ferrocene co-immobilized nanolabel | Aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a signal-on type electrochemical aptasensor (Fe3O4@NMOF-Apt) to rapidly and on-site detect V.P. | Detects V.P in the range of 10–10(9) cfu/mL with an LOD of 3 cfu/mL and within only 20 min. | N/A | Linearized adsorption isotherm | 16.8 nM (with V.P.) and 2.2 ± 0.2 nM (with Fe3O4@NMOF-Apt) | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | No significant difference in the measured blank and signals was observed over 3 months with aptasensor, when 91.3% of the initial signal was obtained. | N/A | N/A | N/A |
| ABdb_1385 | 32905329 | 2020 | Simple Colorimetric Assay for Vibrio parahaemolyticus Detection Using Aptamer-Functionalized Nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a visual colorimetric assay using aptamer-conjugated MNPs and AuNPs for the detection of V. parahaemolyticus. | Shows a linear range of 10-10(6) cfu/mL, with a limit of detection of 2.4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1437 | 32594319 | 2020 | SiC-functionalized fluorescent aptasensor for determination of Proteus mirabilis | Aptamer | TTGCTGTAGGGGAGGAGGGTGGGT | 24 | N/A | ssDNA | Proteus Mirabilis (ATCC 12453) | Whole cell | Developed a fluorescent aptasensor based on aptamer-modified SiC quantum dots (DNA-SiC QDs) for the determination of Proteus mirabilis. | The linear range is from 10(3) to 10(8) CFU/mL, and the limit of detection is 526 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1440 | 31655050 | 2020 | Rapid and sensitive detection of Salmonella with reduced graphene oxide-carbon nanotube based electrochemical aptasensor | S. Typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Develop a biosensor using reduced graphene oxide-carbon nanotubes (rGO-CNT) nanocomposite via the hydrothermal method for label-free electrochemical detection of S. enterica. | Display a wide linear dynamic range from 10(1) until 10(8) cfu/mL with a 10(1) cfu/mL of the limit of detection. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | ssDNA/rGO-CNT/GCE aptasensor showed good to excellent stability when stored for 20 days in ultrapure water at 4°C. | N/A | N/A | N/A |
| ABdb_1453 | 34567619 | 2020 | An aptamer-based shear horizontal surface acoustic wave biosensor with a CVD-grown single-layered graphene film for high-sensitivity detection of a label-free endotoxin | Aptamer | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Endotoxin (Lipopolysaccharide (LPS)) | Developed SH-SAW biosensor with chemical vapour deposition (CVD)-grown single-layered graphene (SLG) for endotoxin detection. | The biosensor exhibited a linear detection range of 0-100 ng/mL and a detection limit (LOD) of 3.53 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1454 | 33241794 | 2020 | Rapid and highly sensitive detection of Salmonella typhimurium in lettuce by using magnetic fluorescent nanoparticles | S. typhimurium aptamer | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop a fluorescent sensor (FMNCs-Apt), based on Fe3O4 magnetic nanoparticles and aptamer-modified carbon quantum dots for the detection of S. typhimurium in lettuce. | Detection limit (LOD) of 100 CFU/mL in vegetable washing solution and 138 CFU/mL in lettuce samples with a linear range of 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1486 | 32151909 | 2020 | Surface-enhanced Raman spectroscopic-based aptasensor for Shigella sonnei using a dual-functional metal complex-ligated gold nanoparticles dimer | S. Sonnei aptamer | TGAGCCCAAGCCCTGGTATGTTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCCGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Shigella Sonnei (ATCC 51334) | Whole cell | Developed a SERS aptasensor using a composite material integrated with the Raman active 4-MBA ligand of the Eu-complex and citrate-stabilised Au nanoparticles (cit-Au NPs) for the detection of S. sonnei. | Showed a good linear relationship in the range of 10–10(6) cfu/mL with a limit of detection (LOD) as low as 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1493 | 32800140 | 2020 | Developing a dual-RCA microfluidic platform for sensitive E. coli O157:H7 whole-cell detections | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Lipopolysaccharide (LPS) | Developed a dual-RCA microfluidic platform for sensitive detection of E. coli O157:H7 cells. | Achieved a linear range of 10(2) - 10(5) cells/mL with the limit of detection of 80 cells/mL in both orange juice and milk, thereby increasing overall detection signal intensities by approximately 250 times. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) and 3'-Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1499 | 32200887 | 2020 | DNA aptamer-based non-faradaic impedance biosensor for detecting E. coli | OMP Ag1 aptamer | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | N/A | ssDNA | Escherichia Coli (E. Coli) BL21 strain | Outer membrane protein Ag1 (E. coli OMP Ag1) | Developed an impedance-based biosensor using aptamer-functionalized Interdigitated Electrode (IDE) arrays to detect E. coli. | Detection limit of 9 cfu/mL and linear concentration range of 25–1000 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1540 | 34664941 | 2021 | Efficient Eradication of Bacterial Biofilms with Highly Specific Graphene-Based Nanocomposite Sheets | S. Typhimurium aptamer (ST-NH2) | TTTTTAAGCCCACTGGCGTTCGGACATCACAGCTCGTGCAGGTCGTGCCATG | 52 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (CMCC 50115) | Whole cell | ICG@GO-Apt nanosheets for eradication of biofilm associated with Salmonella Typhimurium. | Shows an efficient biofilm elimination with an efficiency of greater than 99.99% in an abscess formation model. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) or TAMRA, 5'-FAM Labeled or Amidation (NH₂) | ICG@GO-Apt NSs had almost no cytotoxicity to HEK 293 cells, with more than 90% and lacked hemolytic activities. | N/A | N/A | N/A | N/A |
| ABdb_1544 | 34051601 | 2021 | Sensitive detection of S. Aureus using aptamer- and vancomycin -copper nanoclusters as dual recognition strategy | Aptamer | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed an aptamer- and antibiotic-based dual detection sensor, combines copper nanoclusters (CuNCs) for the detection of S. aureus. | Showed a linear range of 10(2)-10(8) CFU/mL, and a detection limit of 80 CFU/mL after 45 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1548 | 34396009 | 2021 | DNA Aptamer-Conjugated Magnetic Graphene Oxide for Pathogenic Bacteria Aggregation: Selective and Enhanced Photothermal Therapy for Effective and Rapid Killing | MRSA aptamer | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGACGTGACGCAGC-N38-TGGACACGGTGGCTTAGTA-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Apt@MGO nanoplatform for selective and rapid eradication of MRSA under NIR laser irradiation. | Apt@MGO resulted in ∼78% MRSA and over >97% MRSA cell inactivation in dispersed and aggregated states, respectively, under 200 seconds of exposure to NIR irradiation (808 nm, 1.1 W cm–2). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 3'-Amidation (NH₂) and 5'-FITC Labeled | The aptamer itself did not cause any cell activation when incubated with MRSA cells, and also under no NIR laser illumination. | N/A | N/A | N/A | N/A |
| ABdb_1551 | 33076147 | 2021 | Ratiometric fluorescence resonance energy transfer aptasensor for highly sensitive and selective detection of Acinetobacter baumannii bacteria in urine sample using carbon dots as optical nanoprobes | Ab aptamer | CAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 71 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | Develop an ingenious ratiometric fluorescent aptasensor for the detection of (Ab) bacteria based on FRET between ortho-phenylenediamine carbon dots (o-CD), nitrogen-doped carbon nanodots (NCND), and graphene oxide (GO). | Display linear range from 2.0 × 10(3) to 4.5 × 10(7) cfu/mL and the low detection limit of 3.0 × 10(2) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After a storage period of 4 weeks, over 90% of the initial response remained of the aptasenosr. | N/A | N/A | N/A |
| ABdb_1552 | https://doi.org/10.1016/j.microc.2021.106388 | 2021 | Rapid and sensitive determination of Pseudomonas aeruginosa by using a glassy carbon electrode modified with gold nanoparticles and aptamer-imprinted polydopamine | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Develop an electrochemical sensor based on a combination of aptasensing and molecular imprinting employing GCE/AuNP/Aptamer-MIP for ultrasensitive detection of P. aeruginosa. | Exhibited a wide linear dynamic concentration range of 10(1) to 10(7) CFU/ml with a low detection limit of 1 CFU/ml. | N/A | N/A | N/A | Detection | N/A | 5'-Amidation (NH₂) | N/A | The GCE/AuNP/Aptamer-MIP aptasensor signal remained unchanged, and only a 3% decrease in the peak current occurred after 50 repetitive cycles. | N/A | N/A | N/A |
| ABdb_1553 | 34578762 | 2021 | Aptasensor for the Detection of Mycobacterium tuberculosis in Sputum Utilising CFP10-ESAT6 Protein as a Selective Biomarker | Aptamer | GCCTGTTGTGAGCCTCCTAACCCCATCTTATACGTATATGGACTCATCTCGACCCCCGATAGGCTTGGTACATGCTTATTCTTGTCTCCC | 90 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT6/CFP10 fusion proteins (EC proteins) | Developed a portable electrochemical aptamer-antibody-based sandwich biosensor via CapApt/GP/PANI-modified SPGE surface for M. tb. detection in clinical sputum samples. | Detection of the CFP10-ESAT6 antigen ranged from 5 to 500 ng/mL, with a detection limit of 1.5 ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1569 | 33479797 | 2021 | A turn-on-type fluorescence resonance energy transfer aptasensor for vibrio detection using aptamer-modified polyhedral oligomeric silsesquioxane-perovskite quantum dots/Ti3C2 MXenes composite probes | VP aptamer | TTTTTTTTTCAACGAAACAGTGACTCGTTG | 30 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a turn-on–type aptasensor based on FRET pair using aptamer modified polyhedral oligomeric silsesquioxane-perovskite quantum dots (POSS-PQDs-Apt) as signal probe and titanium carbide (Ti3C2) MXenes as quencher for Vibrio parahaemolyticus (VP) determination. | Under optimized conditions, the assay can determine VP in the concentration range 10(2) - 10(6) cfu/mL with the detection limit (LOD) of 30 cfu/mL and 100 cfu/mL by naked eye in aquaculture water. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1581 | 33303152 | 2021 | Hollow carbon nanocapsules-based nitrogen-doped carbon nanofibers with rosary-like structure as a high surface substrate for impedimetric detection of Pseudomonas aeruginosa | Aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical aptasensor based on hollow carbon nanocapsule-based nitrogen-doped carbon nanofibers (CNCNF) with a rosary-like structure for the detection of PA. | The linear range and LOD of the aptasensor were 101-107 CFU/ml and 1 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | After 8 days of storage in Fe(CN)6 3-/4- at 4°C, the electrode was found to be 89% of its initial activity. | N/A | N/A | N/A |
| ABdb_1585 | 34970724 | 2021 | Colorimetric determination of Listeria monocytogenes using aptamer and urease dual-labeled magnetic nanoparticles and cucurbit[7]uril-mediated supramolecular assembly of gold nanoparticle | Aptamer | TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 57 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19111) | Whole cell | Developed a colorimetric strategy using apt-MNP-urease conjugate for the detection of L. monocytogenes. | Achieved a concentration range from 10 to 10(6) cfu/mL, and the visual determination can be done down to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1596 | 34406747 | 2021 | Upconversion Nanoprobes Based on a Horseradish Peroxidase-Regulated Dual-Mode Strategy for the Ultrasensitive Detection of Staphylococcus aureus in Meat | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a colorimetric and fluorescent dual-mode nanoprobe using apt-MNPs and HRP-UCNPs-cDNA for the detection of S. aureus. | Obtained limits of detection of 22 CFU/mL for fluorescence and 20 CFU/mL for colorimetry in a linear range of 56–5.6 × 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1597 | https://doi.org/10.1007/s13738-021-02384-9 | 2021 | Rapid and sensitive detection of Escherichia coli O157:H7 based on silver nanocluster fluorescent probe | E. coli O157:H7 aptamer | TGAGCCCAAGCCCTGGTATGCGGATAACGAGGTATTCACGACTGGTCGTCAGGTATGGTTGGCAGGTCTACTTTGGGATC | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Detection of E. coli O157:H7 in food based on aptamer-modified silver nanocluster fluorescent probes. | The linear range was 10–10(6) CFU/mL, and the detection limit was 0.2549 CFU/mL in the buffer and 0.6031 CFU/mL in the milk simulation sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1606 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E8 | TAGGGAAGAGAAGGACATATGA-CATTCTGCACCGCCATCAGTCTTTCTTCGATACCGCGTTT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | The limit of detection observed visually was 10(2) cells/mL with GO coating and 10(3) cells/mL without GO. The detection limit in real-time coconut water samples was also 10(2) cells/mL. | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 15.90 ± 3.07 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled, 5'-Thiolated and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1653 | 35200347 | 2022 | Paper-Based Electrodes Conjugated with Tungsten Disulfide Nanostructure and Aptamer for Impedimetric Detection of Listeria monocytogenes | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed an aptasensor based on ePAD that employs a tungsten disulfide (WS2)/aptamer hybrid for the detection of L. monocytogenes. | The limit of detection (LoD) was 10 CFU/mL, with a linear range of 10(1)-10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | Aptasensor gives a stable impedance response over a period of 15 days. | N/A | N/A | N/A |
| ABdb_1671 | 34329020 | 2022 | Targeted mesoporous silica nanoparticles for improved inhibition of disinfectant resistant Listeria monocytogenes and lower environmental pollution | A15-HP-Am | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGATAGTA | 40 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115 and ATCC 7644) | Whole cell | BAC-encapsulated, aptamer-functionalized silica nanoparticles (AptBACNP) effectively killed only the target bacterium, L. monocytogenes, at lower doses, but not other bacteria. | Inhibition (MIC value) of BAC resistant Listeria strains with 8 times less the usual disinfectant dose. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Amidation (NH₂) | MSNPs are slightly cytotoxic to erythrocytes and MCF-7 cells at concentrations more than 25 µg/ml. | N/A | N/A | N/A | N/A |
| ABdb_1672 | 35850461 | 2022 | Aptamer decorated emodin nanoparticles-assisted delivery of dermcidin-derived peptide DCD-1L: Photoactive bio-theragnostic agent for Enterococcus faecalis biofilm destruction | Aptamer | TAGGGAAGAGAAGGACATATGATACTGGCCTTGACACCCTGTTGTGGCTTGATGACAATAACATTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Enterococcus Faecalis | Whole cell | Apt@EmoNp-DCD-1L that binds E. faecalis, enabling targeted delivery of emodin nanoparticles and DCD-1L for anti-biofilm activity. | aPDT using Apt@EmoNp-DCD-1L caused ≈99.99% reduction of E. faecalis viability and strong biofilm disruption at sub-MIC concentrations (7.8 and 15.6 µM). | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1713 | 36354505 | 2022 | Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis Diagnosis | MPT64 aptamer | TTTTTTTTTTGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 44 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Amperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB. | Achieved a detection limit of 1.82 ng/mL and a linear range of 0.75–250 ng/mL for MPT64 antigen within 2.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1714 | 36354505 | 2022 | Simultaneous Amperometric Aptasensor Based on Diazonium Grafted Screen-Printed Carbon Electrode for Detection of CFP10 and MPT64 Biomarkers for Early Tuberculosis Diagnosis | CFP10 aptamer | N/A | N/A | N/A | N/A | Mycobacterium Tuberculosis (M.Tb.) | CFP10 antigen | Amperometric dual aptasensor for the simultaneous detection of M. tb. secreted antigens CFP10 and MPT64 for the diagnosis of TB. | Achieved a detection limit of 1.68 ng/mL and a linear range of 0.5–100 ng/mL for CFP10 antigen within 2.5 h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1720 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B46 | GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | LOD value as low as 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 616 ± 13 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1721 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B48 | GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1722 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B70 | GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 632 ± 132 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1723 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B72 | GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1724 | 35270999 | 2022 | Detection of E. coli Bacteria in Milk by an Acoustic Wave Aptasensor with an Anti-Fouling Coating | Aptamer | ATCCGTCACACCTGCTCTACGGCGCTCCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT | 74 | N/A | ssDNA | Escherichia Coli (E. Coli) DH5α | Whole cell | Developed an electromagnetic piezoelectric acoustic sensor device (EMPAS) based on SiO2-MEG-NH2-Aptamer for the detection of E.coli. in milk samples. | Selective measurement of E. coli in PBS and in cow’s milk samples down to limits of detection of 35 and 8 CFU/mL, respectively, with a linear range of 10–10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1741 | 34802926 | 2022 | Rapid and selective detection of Bacillus cereus in food using cDNA-based up-conversion fluorescence spectrum copy and aptamer modified magnetic separation | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus | Whole cell | Developed an aptansensor for Bacillus cereus detection based on up-conversion and magnetic nanomaterials (UCNPs-cDNA-Apt-MNPs complex). | Display a linear range of 49-49 × 10(6) cfu/mL under the optimal conditions with a detection limit of 22 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1743 | 36192057 | 2022 | Aptamer-based colorimetric detection of methicillin-resistant Staphylococcus aureus by using a CRISPR/Cas12a system and recombinase polymerase amplification | Aptamer 2 | CCTCCCTCCCTCCCTTTTTCCCACCCACCCACC | 33 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Developed an aptamer-based colorimetry sensor using a CRISPR/Cas12a system and recombinase polymerase amplification (RPA) for sensitive detection of MRSA. | MRSA was detected as low as 8 CFU/mL and can be quantified with a linear range of 10 CFU/mL to 10(5) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1745 | https://doi.org/10.1016/j.snb.2021.130839 | 2022 | A dual-mode aptasensor for foodborne pathogens detection using Pt, phenylboric acid and ferrocene modified Ti3C2 MXenes nanoprobe | V.P-Apt | TTTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA | 38 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a dual-mode aptasensor based on electrochemical and colorimetric modes using PBA-Fc@Pt@MXenes nanoprobe for the detection of V.P in shrimps. | Showed a LOD and linear range of 5 CFU/mL and 10(1) to 10 (8) CFU/mL by electrochemical mode and 30 CFU/mL and 10(2) to 10 (8) CFU/mL by coulometric mode. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The electrochemical signal retained 89.6% of its original value after 2 weeks. | N/A | N/A | N/A |
| ABdb_1782 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1783 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1809 | 37619902 | 2023 | Development of a label-free impedimetric aptasensor for the detection of Acinetobacter baumannii bacteria | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | An electrochemical aptasensor was developed using an aptamer immobilized on the surface of a CSPE modified with the nanocomposite Fe3O4@SiO2@Glyoxal (Gly) for A. baumannii detection. | Specifically detect A. baumannii in the concentration range from 1.0 × 10(3)–1.0 × 10(8) CFU/mL and with a detection limit of 150 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current response from 0 day to 28 days was 94.3%, 90%, and 86.5% of the primary Rct response of the aptasensor remained at 4°C after 14, 21 and 28 days, respectively. | N/A | N/A | N/A |
| ABdb_1816 | 36493674 | 2023 | Sandwich-Type Electrochemical Aptasensor for Highly Sensitive and Selective Detection of Pseudomonas Aeruginosa Bacteria Using a Dual Signal Amplification Strategy | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15442) | Whole cell | Developed a sandwich-type electrochemical aptasensor using a carbon screen-printed electrode (MIL101(Cr)/MWCNT) and AgNPs/C-g-C3N4/Apt for P. aeruginosa detection. | Display a limit of detection of 1 CFU/mL and a linear range of 10 to 10(7) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The DPV current intensity of the aptasensor for 10(5) CFU/mL of P. aeruginosa was approximately 92.4% of its initial signals after 21 days stored at 4°C. | N/A | N/A | N/A |
| ABdb_1828 | 37466698 | 2023 | A signal-off aptasensor for the determination of Acinetobacter baumannii by using methylene blue as an electrochemical probe | Apt | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Developed an electrochemical aptasensor with Apt/MWCNT@Fe3O4@SiO2-Cl/CSPE nanocomposite to detect A. baumannii. | Display a linear range of 10.0–1.0 × 10(7) CFU/mL and a detection limit of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | The current density of the aptasensor for 10(5) CFU/mL of A. baumannii was approximately 92.3% of its initial signals after 21 days. | N/A | N/A | N/A |
| ABdb_1838 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-F23 was 1.42 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1839 | https://doi.org/10.1002/adfm.202403440 | 2024 | Next-Generation Wound Care: Aptamer-Conjugated Polydiacetylene/Polyurethane Nanofibrous Biosensors for Selective In Situ Colorimetric Detection of Pseudomonas | St21Lp17 | AAGCGTCGGTGTTCTATCGGTAGTTGACACCGACGCCT | 38 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed an aptamer-modified polydiacetylene-based electrospun nanofibrous wound dressing for the detection of Pseudomonas aeruginosa. | The LOD for the aptamer-modified membrane P-St21Lp17 was 4.46 × 10(6) CFU/cm^2. | N/A | N/A | N/A | Biosensor | N/A | Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1842 | 39533298 | 2024 | Rapid detection of Brucella cells using a gold nanoparticle-based aptasensor via a simple colorimetric method | B. melitensis-specific aptamer | GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC | 38 | N/A | ssDNA | Brucella Melitensis strain Rev. 1 vaccine and Brucella Abortus strain RB51 vaccine | Whole cell | Detection of Brucella cells using a biosensor, based on gold nanoparticles (GNPs) and a specific aptamer, via a colorimetric reaction. | Able to detect 1.5 × 10(1) CFU/mL with a linear range of 1.5 × 10(1)-1.5 × 10(8) CFU/mL of the bacterial cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1904 | 40517569 | 2025 | Ultrasensitive electrochemical aptasensor for Pseudomonas aeruginosa detection using N-doped MWCNTs/AgNPs nanocomposite | F23 | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa | Whole cell | Developed an electrochemical P.A. biosensor based on N-MWCNTs/AgNPs-10/Apt for the detection of P. aeruginosa. | Exhibited a wide linear detection range from 10(-1) to 10(6) CFU/mL, and the limit of detection is 0.0798 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1921 | 40053147 | 2025 | Fluorescent aptasensor for detection of Salmonella typhimurium using boric acid-functionalized terbium metal-organic framework and magnetic nanoparticles | Aptamer | TAGGGAAGAGAAGGACATATGATCAGGAGTCATGCTACCACTGGTGATTACGCCTCGCTCAGCTTGACTAGTACATGACCACTTGA | 86 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (MTCC 3232) | Whole cell | A fluorescent detection platform was developed using boric acid-functionalized terbium metal–organic framework (BA-Tb-MOF) and carboxyl-modified magnetic nanoparticles (MNPs) to identify S. typhimurium. | Showed an inverse linear relationship within the range of 10(1)–10(9) CFU/mL, and the detection limit was 4 CFU/mL. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1926 | 40136943 | 2025 | Nanoparticle-Enhanced Acoustic Wave Biosensor Detection of Pseudomonas aeruginosa in Food | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa PAO1 | Whole cell | Developed a biosensor for detecting P. aeruginosa in whole milk samples using an aptamer functionalized antifouling linking molecule 3-(2-mercaptoethanoxy)propanoic acid (HS-MEG-COOH), and another one with the addition of AuNPs. | Exhibited a linear range 10(2)-10(5) CFU/mL and limit of detection (LOD) of 86 CFU/mL in PBS and 157 CFU/mL in milk, and with AuNPs, reducing the extrapolated LOD to 68 CFU/mL in PBS and 46 CFU/mL in milk. | N/A | N/A | N/A | Biosensor | N/A | 3'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1945 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt1 & Apt3 | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1946 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt2 & Apt4 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1950 | 41135162 | 2026 | Silver-decorated nanobeads for high-performance and flexible analysis of Shigella dysenteriae utilizing a paper-based aptasensor | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGCAGGGATTAGTCAAGAGGTAGACGCACATA | 86 | N/A | ssDNA | Shigella Dysenteriae | Whole cell | Developed an Ag/MBs-modified paper-based aptasensor to detect S. dysenteriae. | MB-based assays achieve broad linearity (DPV = 10(2)–10(8) CFU/mL, EIS = 10(1)–10(9) CFU/mL) and high sensitivity (DPV = 90 CFU/mL, EIS = 8.09 CFU/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) | N/A | Long stability of up to 28 days at 4°C. | N/A | N/A | N/A |
| ABdb_1957 | 19052851 | 2009 | Plastic-adherent DNA aptamer-magnetic bead and quantum dot sandwich assay for Campylobacter detection | C2 and C3 | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (ATCC 29428) | Surface protein | Identify aptamers against surface proteins from C. jejuni and develop a sandwich assay ( (C2 aptamer-MB-bacteria-C3 aptamer-QD complexes) for its detection. | Exhibits detection limits as low as an average of 2.5 cfu equivalents in buffer and 10–250 cfu in various food matrices. | 5 | N/A | N/A | Biosensor | SELEX | 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2124 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-1 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) are used to develop a triple-module biosensor to capture H. pylori. | Exhibited a wide detection range of 10-10(7) CFU/mL and a limit of detection (LOD) as low as 1 CFU/mL. | 10 | Fluorescence Spectroscopy | 36.91 ± 11.1 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_2125 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-2 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 46.31 ± 11.31 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2126 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-3 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 60.76 ± 11.69 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2127 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-4 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 41.57 ± 16.18 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2128 | 34399193 | 2021 | Aptamer-superparamagnetic nanoparticles capture coupling siderophore-Fe3+ scavenging actuated with carbon dots to confer an "off-on" mechanism for the ultrasensitive detection of Helicobacter pylori | Hp-5 | N/A | N/A | 5'-TGGACCTTGCGATTGCGATTGACAGC-40N-GCAGACATGAGTCTCAGGAC-3' | ssDNA | Helicobacter Pylori (ATCC 700392) | Whole cell | Aptamer-modified superparamagnetic nanoparticles (SPMNPs) capture H. pylori. | N/A | 10 | Fluorescence Spectroscopy | 67.74 ± 10.24 nM | Biosensor | SELEX | 5'-FAM Labeled and 5'-Amidation (NH₂) | N/A | N/A | N/A | N/A | N/A |