Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 34
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0197 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (80nt) | CTCCTCTGACTGTAACCACG-TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0198 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-3 (60nt) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 7.8 ± 6.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0199 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6 (79nt) | CTCCTCTGACTGTAACCACG-TAACGTACCAAAATGTTGGATTGGATGTTGTACTGGGTT-GCATAGGTAGTCCAGAAGCC | 79 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 53 ± 7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0200 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-6_54 | TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAGCC | 54 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.3 ± 0.58 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0201 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_80 | CTCCTCTGACTGTAACCACG-CACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 28 ± 3.8 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0202 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-20_60 | CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis and 43 ± 4% (SE-20, 60nt) in S. enteritidis. | 12 | Flow Cytometry | 7.1 ± 0.62 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0203 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_80 | CTCCTCTGACTGTAACCACG-TATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 30 ± 4.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0204 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-22_60 | CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGATTCAATC | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 5.3 ± 0.7 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0205 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-11_60 | CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATTTTCGCCA | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 6.9 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0206 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | SE-34_80 | CTCCTCTGACTGTAACCACG-TGCCGCTAAACGCCGGCTCATCGTTATGCTTTTCATTGCA-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 73 ± 15% inhibition ratio for S. enteritidis. | 12 | Flow Cytometry | 56 ± 7.1 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0207 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-1_40 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0208 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-6_60 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0209 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_80 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0210 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-12_60 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGT | 59 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium and 62 ± 12% (ST-12, 60nt) in S. typhimurium. | 12 | Flow Cytometry | 4.5 ± 0.4 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0211 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_80 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0212 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-20_40 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | N/A | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0213 | 23387511 | 2013 | Development of bacteriostatic DNA aptamers for salmonella | ST-33_60 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell (bind to antibiotics resistant Salmonella) | Identify an aptamer against the whole cell and induce strong depolarization of the bacterial cell membrane (Inhibition of growth of S. enteritidis and S. typhimurium in bacterial cultures and a decrease in their membrane potential). | 75 ± 15% inhibition ratio for S. typhimurium. | 12 | Flow Cytometry | 51.0 ± 4.3 nM | Therapeutics | Whole Cell-SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0446 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mA_Apt1 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mA_Apt1 (~40% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | Best Candidate | N/A | N/A |
| ABdb_0447 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mB_Apt23 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer mB_Apt23 (~20% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0448 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mC_Apt41 | CACAGCGGGACAGUUUAGC-CAGGCUGUUCUGACGCAUAAGGAAUGCGCUGUUGCAGAG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | mC_Apt41 neutralized 0.007 pmole of Stx2 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0449 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | mD_Apt46 | CACAGCGGGACAGUUUAGC-UUGGUCCUGCUUUGGAUAGUCGCGAAAGGGGUGCCACUG-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0450 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pA_Apt1 | CACAGCGGGACAGUUUAGC-ACAGUUAUCCGACUGCUAUUCGAUCAGGCAGUACGUAGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Inhibited Stx2 binding weakly in approximately 50% of HeLa cells. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0451 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pB_Apt14 | CACAGCGGGACAGUUUAGC-ACCGAGCGGUUUUACGUCUCAAGUAGUAUCCCGUUUUGC-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0452 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pC_Apt22 | CACAGCGGGACAGUUUAGC-AUUAGCUAUCUUCCACGAUUCGAUCAGGCAGUACGUCGU-GGUAGGUGGGUGCGUCUAAA | 78 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | A limited neutralization of Stx2-mediated cytotoxicity and death of HeLa cells was observed with aptamer pC_Apt22 (≤60% cell survival). | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0453 | 24839553 | 2014 | Selective Evolution of Ligands by Exponential Enrichment to Identify RNA Aptamers against Shiga Toxins | pD_Apt25 | CACAGCGGGACAGUUUAGC-UUGCCAUCCUGUACUAUGCUCUAUCGGGCGGUUUAGUGAUCCUUCGUCCAACUAUC-GGUAGGUGGGUGCGUCUAAA | 95 | 5'-CACAGCGGGACAGTTTAGC-N56-GGTAGGTGGGTGCGTCTAAA-3' | ssRNA | Escherichia Coli (E. Coli) | Shiga toxin 2 (Stx2) | Identify RNA aptamers against Stx1 and Stx2. | Did not inhibit Stx2 binding. | 5 | Flow Cytometry | N/A | Detection | Parallel m-SELEX (Membrane) and p-SELEX (Plate) | 2'-Fluoro pyrimidines (2'-F-RNA) and AlexaFluor 488 Labeled | None of the other aptamers neutralized the cytotoxic effects of Stx2. | N/A | N/A | N/A | N/A |
| ABdb_0540 | 25891472 | 2015 | Antibiotic loaded nanocapsules functionalized with aptamer gates for targeted destruction of pathogen | SA20hp | GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT | 45 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Aptamer-gated nanocapsules for the specific targeting of vancomycin to bacteria for the controlled release of vancomycin. | 15-fold increase of efficacy for vancomycin with MIC of 0.420 μg/mL. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-AlexaFluor 488 Labeled and 3'-(PEG)-AGGGCGC-BH1 | MICs of vancomycin-nanoparticles for S. epidermidis (control) were found to be 6.295 µg/mL. | N/A | N/A | N/A | N/A |
| ABdb_1040 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT916 | CATCCGTCACACCTGCTC-GGCAAAAAGGATTGCCCAGGTCTGCTGTCTAGCCGGATTC-GGTGTTGGCTCCCGTATC | 76 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | Detection limits of 2.1 ng/ml in buffer and 2.4 ng/ml in tap water, with a linear range from about 1 ng/ml to 1000 ng/ml. | 12 | Bead-based Affinity Chromatography | 48.5 ± 0.5 nM | Biosensor | SELEX | Amidation (NH₂-(CH2)6) or Biotinylated and AlexaFluor 488 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1041 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT910 | CATCCGTCACACCTGCTC-GTACACAGGAGCCAAACCCAACCAGACCAACCTGAAGCC-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 54.6 ± 6.7 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1042 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT928 | CATCCGTCACACCTGCTC-CACCCGTCACACTTATCCGTCAACTGGGCTCCCACTGGG-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 23.6 ± 1.2 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1043 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT931 | CATCCGTCACACCTGCTC-CCAGCGTGCGTCGAGGGGGACCCCTGTCAGCCCCCTCGCG-GGTGTTGGCTCCCGTATC | 76 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 50.2 ± 13.2 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1044 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT938 | CATCCGTCACACCTGCTC-CACCCGTCCACTCATCCGTCACACCTGTTCTCCCCATG-GGTGTTGGCTCCCGTATC | 74 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 23.2 ± 0.4 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1045 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT939 | CATCCGTCACACCTGCTC-CACCCGTCACACTTATCCGTCACACTGGGCCCCACTGGG-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 41.6 ± 4.0 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1046 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT943 | CATCCGTCACACCTGCTC-CACCCGTCCACTCATCCGACACACCTGCTCTCCCCACTG-GGTGTTGGCTCCCGTATC | 75 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 26.8 ± 0.5 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1047 | 29408200 | 2018 | Highly affine and selective aptamers against cholera toxin as capture elements in magnetic bead-based sandwich ELAA | CT946 | CATCCGTCACACCTGCTC-CCCACAACCGGTCCGGTGTTCGGTCCCCGTATCACGCCCC-GGTGTTGGCTCCCGTATC | 76 | 5'-CATCCGTCACACCTGCTC-N40-GGTGTTGGCTCCCGTATC-3' | ssDNA | Vibrio Cholerae | Cholera toxin (AB5-type toxin composed of a donut-shaped homopentameric B subunit (CT-B)) | Identify aptamers against and develop an MB-based sandwich ELAA to detect CT-B from spiked tap water. | N/A | 12 | Bead-based Affinity Chromatography | 30.4 ± 1.5 nM | Biosensor | SELEX | AlexaFluor 488 Labeled | N/A | N/A | N/A | N/A | N/A |