Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1593 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 10(2) to 10(7) cfu/mL, with a detection limit of 50 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Cy3 and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |