AptBacterialDB

Modification : 5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed Labeled

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1947 412897762026Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applicationsApt1CATCCGTCACACCTGCTCGGTGCAGACCCATAGGGGGGGCGTGCGGATGTGCGGAGTAGGGTGTTCGCTCCCGTATC77N/AssDNABacillus Cereus strain INRA-SV-S51B. cereus sporesDeveloped an electrochemical aptasensor for the detection of B. cereus spores.An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.N/AN/AN/ABiosensorN/A5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed LabeledN/AN/AN/AN/AN/A
ABdb_1948 412897762026Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applicationsApt2CATCCGTCACACCTGCTCCCCAATGAAGCGAGATGGACGCCTAGCACCCCCCGCGTCCGGTGTTGGCTCCCGTATC76N/AssDNABacillus Cereus strain INRA-SV-S51B. cereus sporesDeveloped an electrochemical aptasensor for the detection of B. cereus spores.An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.N/AN/AN/ABiosensorN/A5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed LabeledN/AN/AN/AN/AN/A
ABdb_1949 412897762026Improving electrochemical aptasensor sensitivity for Bacillus cereus spore detection in food safety applicationsBAS6ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT71N/AssDNABacillus Cereus strain INRA-SV-S51B. cereus sporesDeveloped an electrochemical aptasensor for the detection of B. cereus spores.An aptasensor based on three aptamers exhibited a wide dynamic range (10(2)–10(7) CFU/mL) and a low limit of detection (∼1 CFU/mL) using only 15 μL of sample.N/AN/AN/ABiosensorN/A5′-HO(CH2)6SS(CH2)6(T)5 group, or 5'-TexasRed LabeledN/AN/AN/AN/AN/A