Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0820 | https://doi.org/10.1021/acssensors.6b00333 | 2016 | Quantitative Label-Free Listeria Analysis Based On Aptamer Modified Nanoporous Sensor | LM Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed a nanoporous sensor with aptamer combined porous anodic aluminium oxide membrane for detection of L. monocytogenes. | Achieved detection within 10 min, with a high sensitivity of 100 CFU/mL and a good linear range between 100 and 1250 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-CHO | N/A | N/A | N/A | N/A | N/A |