AptBacterialDB

Modification : 5'-and 3'-Biotinylated

Total records found: 5

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0784 276505762016G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONAPA#2/8ATACCAGCTTATTCAATT-AGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT-ACAATCGTAATCAGTTAG765'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'ssDNAStaphylococcus aureus (S. aureus) (P3838, P6031)Staphylococcus aureus Protein A (SpA)Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain.N/AEnzyme-Linked Oligonucleotide Assay (ELONA)101.4 ± 5.9 nM (of 3′-biotinylated)  and 189.9 ± 13.0 nM (of 5′-biotinylated)DetectionN/A5'-and 3'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0785 276505762016G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONAPA#2/8[S1-58]ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT585'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'ssDNAStaphylococcus aureus (S. aureus) (P3838, P6031)Staphylococcus aureus Protein A (SpA)Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.PA#2/8 and its truncated variant PA#2/8[S1-58] were able to differentiate between the highly Protein A-producing S. aureus Cowan strain.N/AEnzyme-Linked Oligonucleotide Assay (ELONA)11.3 ± 1.4 nM (of 3′-biotinylated)  and 23.7 ± 2.0 nM (of 5′-biotinylated)DetectionN/A5'-and 3'-BiotinylatedN/AN/ABest CandidateN/AN/A
ABdb_0786 276505762016G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONAPA#2/8[S1-50]ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTC505'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'ssDNAStaphylococcus aureus (S. aureus) (P3838, P6031)Staphylococcus aureus Protein A (SpA)Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.N/AN/AEnzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionN/A5'-and 3'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0787 276505762016G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONAPA#2/8[S1-43]ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGG435'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'ssDNAStaphylococcus aureus (S. aureus) (P3838, P6031)Staphylococcus aureus Protein A (SpA)Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.N/AN/AEnzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionN/A5'-and 3'-BiotinylatedN/AN/AN/AN/AN/A
ABdb_0788 276505762016G-quadruplex aptamer targeting Protein A and its capability to detect Staphylococcus aureus demonstrated by ELONAPA#2/8[S28-50]AGGGGGATAGAGGGGGTGGGTTC235'-ATACCAGCTTATTCAATT-N40-ACAATCGTAATCAGTTAG-3'ssDNAStaphylococcus aureus (S. aureus) (P3838, P6031)Staphylococcus aureus Protein A (SpA)Develop ELONA to recognise and bind to Staphylococcus aureus presenting Protein A on the cell surface.N/AN/AEnzyme-Linked Oligonucleotide Assay (ELONA)N/ADetectionN/A5'-and 3'-BiotinylatedN/AN/AN/AN/AN/A