Modification : 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4)

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1945	41344010	2026	SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus	Apt1 & Apt3	ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT	81	N/A	ssDNA	Escherichia Coli (E. Coli)	Whole cell	Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus.	The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli.	N/A	N/A	N/A	Biosensor	N/A	5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4)	N/A	N/A	N/A	N/A	N/A
ABdb_1946	41344010	2026	SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus	Apt2 & Apt4	TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT	71	N/A	ssDNA	Staphylococcus aureus (S. aureus)	Whole cell	Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus.	The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus.	N/A	N/A	N/A	Biosensor	N/A	5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4)	N/A	N/A	N/A	N/A	N/A