Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1584 | 34053767 | 2021 | A novel smartphone-based colorimetric aptasensor for on-site detection of Escherichia coli O157:H7 in milk | Aptamer (Apt) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | A colorimetric aptasensor was developed using GNP-Apt coupling with an MWCNT@CIP probe for detecting E. coli O157:H7 in milk. | Display a concentration of 8.43 × 10(3) cfu/mL in pure culture, and 5.24 × 10(2) cfu/mL in artificially contaminated milk after 1h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C6) | N/A | N/A | N/A | N/A | N/A |