Modification : 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1871	38669846	2024	Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors	S. enterica aptamer	TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG	40	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium) (ATCC 14028)	Whole cell	Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens.	Could detect S. enterica at a limit of detection (LOD) as low as 1 CFU in PBS buffer with a linear range from 62.5–6.4 × 10(4) CFU/mL.	N/A	Flow Cytometry	8.9 ± 2.0 nM	Biosensor	N/A	5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1872	38669846	2024	Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors	S. aureus aptamer	AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG	41	N/A	ssDNA	Staphylococcus aureus (S. aureus) (CMCC(B) 26003)	Whole cell	Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens.	Could detect S. aureus at a limit of detection (LOD) as low as 1.2 CFU in PBS buffer with a linear range from 10(2)-1.28 × 10(4) CFU/mL.	N/A	Flow Cytometry	0.65 ± 0.2 μM	Biosensor	N/A	5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled	N/A	N/A	N/A	N/A	N/A