Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 43
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0025 | 17265180 | 2007 | Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores | Aptamer | CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC | 60 | N/A | ssDNA | Bacillus Thuringiensis (BT) | BT spores | Aptamer coupled to fluorescent zinc sulfide-capped, cadmium selenide quantum dots (QD) for detecting BT spores. | Limit of detection (LOD) between 10³ and 10(4) CFU. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0147 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B1 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | Achieved a linear detection range of 0.01 to 1 ng/mL of LPS with a detection time of less than 15 minutes. | 3 | Surface Plasmon Resonance (SPR) | 20 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0148 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B2 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 12 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0149 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B3 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGTTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 32 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0150 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B4 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 21 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0151 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B5 | CTTCTGCCCGCCTCCTTCC-CTAAGCACAGGGAAACCAGCTAATGAGTTAGGCCTGTCCCCCACG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 484 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0152 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B6 | CTTCTGCCCGCCTCCTTCC-CAATGGACCTATTCGAGTACTGAATAGAACAGTCGGCGCTCTGGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 298 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0153 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B7 | CTTCTGCCCGCCTCCTTCC-TTCAAGACGATGCCTGGCGCGAGTTACACACTTGCATGGAGCTGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 61 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0154 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B8 | CTTCTGCCCGCCTCCTTCC-ATCCAATACCTCAGAACTCAGTTCGAGTCGTAAAGGGGAATCGCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 71 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0155 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B9 | CTTCTGCCCGCCTCCTTCC-ACCGATCCATCGAGTTTCTGAGAAAGGCCCGGAGAAACCGCGAGA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 15 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0156 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B10 | CTTCTGCCCGCCTCCTTCC-TCAATCTAACCATGCATGCAGTTTAGGCAGGATTCGTTATCGCAA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 2336 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0157 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-1 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTG | 46 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0160 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-4 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0162 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-6 | CTCCTCTGACTGTAACCACG-GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0163 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-7 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0627 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Secondary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 129 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0948 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0949 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1066 | 29896641 | 2018 | Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop SERS-based aptasensor using DNA-assembled gold nanodimers (AuNDs) for detection of S. typhimurium. | Display a linear range in the 10(2) to 10(7) cfu/mL, and the limit of detection is 35 cfu/mL within 1hr. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1191 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy employing an ultrasensitive aptasensor for the voltammetric determination of M. tuberculosis. antigen MPT64 in human serum. | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1192 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy where two different aptamers are immobilized on a gold electrode to synergistically bind the target MPT64 protein | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1195 | 30019137 | 2018 | Aptamer based voltammetric biosensor for Mycobacterium tuberculosis antigen ESAT-6 using a nanohybrid material composed of reduced graphene oxide and a metal-organic framework | ESAT-6 binding aptamer (EBA) | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Develop a voltammetric aptasensor employing P-MOF-rGO nanohybrid as the sensitive sensing platform for ultrasensitive detection of ESAT-6. | Linear range: 1.0×10(−4) to 2.0×10(2) ng/mL and Limit of Detection (LOD): 3.3×10(−5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Compared with the initial current response, the aptsensor response decreased only about 3.5% after 50 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1198 | 30359519 | 2018 | Ω-Shaped Fiber-Optic Probe-Based Localized Surface Plasmon Resonance Biosensor for Real-Time Detection of Salmonella Typhimurium | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-immobilized Ω-shaped fiber-optic localized surface plasmon resonance (FOLSPR) biosensor for S. Typhimurium detection. | Achieved high detection sensitivity for S. Typhimurium down to 128 CFU/mL within a linear range from 5 × 10(2) to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1325 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅰ (MAA Ⅰ) | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1326 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅱ (MAA Ⅱ) | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1329 | 31410576 | 2019 | Electrochemical determination of Salmonella typhimurium by using aptamer-loaded gold nanoparticles and a composite prepared from a metal-organic framework (type UiO-67) and graphene | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An aptamer-based assay based on a metal-organic framework-graphene composite of type UiO-67/GR and an aptamer-gold nanoparticles-horseradish peroxidase (Apt-AuNP-HRP) conjugate is described for the determination of S.typhimurium. | Linear detection range from 2 × 10(1) – 2 × 10(8) cfu/mL and a lower detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | 91.3% of the original current is retained after storage at 4°C for 14 days with the modified electrodes, allowing monitoring of 2 × 10(5) cfu/mL S. typhimurium. | N/A | N/A | N/A |
| ABdb_1412 | https://doi.org/10.1111/jfs.12868 | 2020 | Ultrasensitive detection of Listeria monocytogenes using solid-state electrochemiluminescence biosensing based on the quenching effect of ferrocene on ruthenium pyridine | Aptamer (ssDNA) | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115, Serotype 4 b) | Whole cell | Developed an ECL biosensing switch system based on the specific recognition of an aptamer and the destruction of pyridine ruthenium by ferrocene for the detection of L. monocytogenes. | Produced a good linear relationship over the concentration range of 1.4 × 10(1)–1.4 × 10(6) CFU/ml and a detection limit of 4 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1652 | 35870283 | 2022 | An ultrasensitive and dual-recognition SERS biosensor based on Fe3O4@Au-Teicoplanin and aptamer functionalized Au@Ag nanoparticles for detection of Staphylococcus aureus | S. aureus Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | The SERS biosensor based on Fe3O4@Au-Tcp NPs as a capture probe and Au@Ag-DTNB-Apt NPs as a signal probe for the detection of S. aureus. | Showed detection limit of 1.09 CFU/mL with a broad dynamic linear range of 7.6 × 10(1)-7.6 × 10(7) CFU/mL within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1817 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 10473) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 5.70 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1818 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | E. coli aptamer | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1819 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. flexneri aptamer | CAGCAACACTGCAACACTGTATAGTCCTGTGTGCC | 35 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.72 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1820 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (CICC 21636) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.84 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1821 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.27 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1822 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21635) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.16 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1871 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. enterica aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. enterica at a limit of detection (LOD) as low as 1 CFU in PBS buffer with a linear range from 62.5–6.4 × 10(4) CFU/mL. | N/A | Flow Cytometry | 8.9 ± 2.0 nM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1872 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. aureus aptamer | AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG | 41 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC(B) 26003) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. aureus at a limit of detection (LOD) as low as 1.2 CFU in PBS buffer with a linear range from 10(2)-1.28 × 10(4) CFU/mL. | N/A | Flow Cytometry | 0.65 ± 0.2 μM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1894 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | LPS Aptamer | TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) DH5α | Lipopolysaccharide (LPS) | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect E. coli with a limit of detection of 2 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1895 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) strain SH1000 | Whole cell | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect S. aureus with a limit of detection of 4 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |