Modification : 5'-Thiolated (HS(CH2)6-(CH2CH2O)6-TTTTT)

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1893	41245639	2025	Simultaneous and sensitive detection of Mycobacterium tuberculosis and SARS-CoV-2 antigens employing an electrochemical impedance spectroscopy aptasensor	MPT64 aptamer sequence (17)	GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC	40	N/A	ssDNA	Mycobacterium Tuberculosis (M.Tb.)	MPT64 protein	Develop an EIS-based aptasensor fabricated to detect MPT64 and S-glycoprotein simultaneously, employing a dual-platform approach on a screen-printed gold electrode (SPGE).	Achieved detection limits of 0.053 pg/mL in buffer and in human serum of 0.085 pg/mL with a linear range of 0.01 pg/mL to 10 pg/mL in both buffer and human serum.	N/A	N/A	8.92 nM	Biosensor	N/A	5'-Thiolated (HS(CH2)6-(CH2CH2O)6-TTTTT)	N/A	The aptasensor maintained good storage stability for up to 22 days.	N/A	N/A	N/A