Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 117
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0025 | 17265180 | 2007 | Fluorescence assay based on aptamer-quantum dot binding to Bacillus thuringiensis spores | Aptamer | CATCCGTCACACCTGCTCTGGCCACTAACATGGGGACCAGGTGGTGTTGGCTCCCGTATC | 60 | N/A | ssDNA | Bacillus Thuringiensis (BT) | BT spores | Aptamer coupled to fluorescent zinc sulfide-capped, cadmium selenide quantum dots (QD) for detecting BT spores. | Limit of detection (LOD) between 10³ and 10(4) CFU. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0147 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B1 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | Achieved a linear detection range of 0.01 to 1 ng/mL of LPS with a detection time of less than 15 minutes. | 3 | Surface Plasmon Resonance (SPR) | 20 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0148 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B2 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 12 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0149 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B3 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGTTGGCCAGATGATATAAAGGGTCAACCCCCCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 32 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0150 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B4 | CTTCTGCCCGCCTCCTTCC-TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAACCCCCCG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 21 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0151 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B5 | CTTCTGCCCGCCTCCTTCC-CTAAGCACAGGGAAACCAGCTAATGAGTTAGGCCTGTCCCCCACG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 484 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0152 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B6 | CTTCTGCCCGCCTCCTTCC-CAATGGACCTATTCGAGTACTGAATAGAACAGTCGGCGCTCTGGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 298 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0153 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B7 | CTTCTGCCCGCCTCCTTCC-TTCAAGACGATGCCTGGCGCGAGTTACACACTTGCATGGAGCTGG-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 61 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0154 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B8 | CTTCTGCCCGCCTCCTTCC-ATCCAATACCTCAGAACTCAGTTCGAGTCGTAAAGGGGAATCGCA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 71 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0155 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B9 | CTTCTGCCCGCCTCCTTCC-ACCGATCCATCGAGTTTCTGAGAAAGGCCCGGAGAAACCGCGAGA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 15 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0156 | 22370280 | 2012 | Harnessing aptamers for electrochemical detection of endotoxin | B10 | CTTCTGCCCGCCTCCTTCC-TCAATCTAACCATGCATGCAGTTTAGGCAGGATTCGTTATCGCAA-GGAGACGAGATAGGCGGACACT | 86 | 5'-CTTCTGCCCGCCTCCTTCC-45N-GGAGACGAGATAGGCGGACACT-3' | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L4524) | Lipopolysaccharide (LPS) | Identify aptamers showing specific affinity to LPS and develop an electrochemical aptasensor on a gold surface for its detection. | N/A | 3 | Surface Plasmon Resonance (SPR) | 2336 nM | Biosensor | NECEEM-based non-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0157 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-1 | CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTG | 46 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0158 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-2 | ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCAT | 40 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0159 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-3 | GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC | 39 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | Successfully detect S. typhimurium down to 600 CFU/mL (equivalent to 18 live cells in 30 μL of assay volume) and distinguish it from other Salmonella species, including S. enteritidis and S. choleraesuis. | 12 | Flow Cytometry | 25 nM | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0160 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-4 | CTCCTCTGACTGTAACCACGGTGGGAGAGATGCTATACAATCTTGTAAGGCGATGGACCG | 60 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0161 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-5 | GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTCGCATAGGTAGTCCAGAAGCC | 61 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0162 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-6 | CTCCTCTGACTGTAACCACG-GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0163 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-7 | CTCCTCTGACTGTAACCACG-GTGGTTTGATCACTATTGGGCCTTTGTGATGTCGGTAGTC-GCATAGGTAGTCCAGAAGCC | 80 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0164 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-8 | CTCCTCTGACTGTAACCACG-GCCTCTAAGGCTCACCTTGAAGCGCCCGGACTAACCTGCTC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0165 | 23075417 | 2012 | Aptamer-based viability impedimetric sensor for bacteria | STYP-9 | CTCCTCTGACTGTAACCACG-ATTGTACACCATGTGCAGAGATTTTCGGCACGAGGATCATC-GCATAGGTAGTCCAGAAGCC | 81 | 5'-CTCCTCTGACTGTAACCACG-N40-GCATAGGTAGTCCAGAAGCC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify aptamers against viable S. typhimurium and develop an aptamer-based impedimetric sensor for bacterial viability (AptaVISens-B). | N/A | 12 | Flow Cytometry | N/A | Detection | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0341 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA I | GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGC | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0342 | https://doi.org/10.1016/j.snb.2013.01.062 | 2013 | A label-free DNA aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins | ECA II | ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA | 37 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC® 8739™) | Outer membrane protein (OMP) | Developed a label-free aptamer-based impedance biosensor for the detection of E. coli outer membrane proteins (OMPs). | Demonstrated in a dynamic detection range of 1 × 10(-7)–2 × 10(-6) M. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0397 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G11-5 | ATACATCTTAAGTCTCGTGGGGGGAGGGGGGGTTGGTGGGCTTT | 44 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | β-structure of membrane associated protein | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | Colorimetric assay demonstrated detection of S. mutans cells at a concentration range of 1 × 10(5)-10(8) CFU/mL. | 11 | Flow Cytometry | 33 nM | Detection | In Silico Maturation (ISM) | 5'-Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0413 | 24445115 | 2014 | An aptamer-based electrochemical biosensor for the detection of Salmonella | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Aptamer-based electrochemical biosensor for Salmonella detection. | A detection limit of 3 cfu/mL was achieved, with a linear range of 2.4 cfu/mL to 2.4 × 10^3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0455 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 2 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0627 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Secondary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 129 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0692 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0700 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 15 cfu/mL for S. typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0701 | 26241735 | 2015 | Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A GNPs-modified Raman-based biosensor was developed for the simultaneous detection of S. typhimurium and S. aureus. | Linear detection range of 10^2 to 10^7 cfu/mL for both; LOD of 35 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0806 | 26599860 | 2016 | Salmonella typhimurium detection using a surface-enhanced Raman scattering-based aptasensor | Apt1 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A SERS-based aptasensor bearing Au@Ag core/shell nanoparticles (NPs) functionalized with apt 1 and X-rhodamine (ROX)-modified apt 2 was developed for the detection of bacteria. | A calibration curve is obtained in the range of 15 to 1.5 × 10(6) CFU/mL with a limit of detection of 15 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0816 | 27063716 | 2016 | Magnetic Nanoparticles-based Aptasensor Using Gold Nanoparticles as Colorimetric Probes for the Detection of Salmonella typhimurium | S. typhimurium aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor for S. typhimurium detection using gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs). | The assay shows a linear response over a range of 25 to 10(5) cfu/mL, and the detection limit was improved to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for Apt1) and 5'-Biotinylated (for Apt2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0821 | https://doi.org/10.1016/j.foodcont.2015.11.031 | 2016 | Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A SERS-based aptasensor was developed using Au@Ag core-shell nanoparticles for the detection of V. parahaemolyticus. | Achieved a concentration in the linear range of 10–10(6) cfu/mL, with a limit of detection of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt 1) and 5'-Cyanine3 (Cy3) Labeled (for apt 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0822 | https://doi.org/10.1039/C6AY02623K | 2016 | SERS aptasensor detection of Salmonella typhimurium using a magnetic gold nanoparticle and gold nanoparticle based sandwich structure | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a SERS aptasensor using aptamer-functionalized magnetic gold nanoparticles (MGNPs) and mercaptobenzoic acid (4-MBA) functionalized gold nanoparticles (GNPs) based sandwich structure for the detection of S. typhimurium. | Exhibit a good linear range from 10 cfu/mL to 10(7) cfu/mL, and the LOD is 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0920 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 1 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | The detection time for M. tuberculosis was 70 min, and the detection limit was 100 cfu/mL. | 14 | Fluorescence Spectroscopy | 37 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0921 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 2 | GGGAGCTCAGAATAAACGCTCAA-GGCACACAGGACTATACAGTGTTGCAGTGTTGCTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 97 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0922 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 3 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 101 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0923 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 4 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 98 ± 7 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0924 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 5 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTACCCGATATGTGTCCGAGTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 96 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0925 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 6 | GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC | 55 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 103 ± 6 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0926 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 7 | GGGAGCTCAGAATAAACGCTCAA-GGCAGGTGGTGTTGGTTGGTTGTGCGTGGAGTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 107 ± 9 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0927 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 8 | GGGAGCTCAGAATAAACGCTCAA-GGCAGCAGCAATGTAACACTGTGTGTATGTGTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 102 ± 8 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0928 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer 9 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 108 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0929 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer10 | GGGAGCTCAGAATAAACGCTCAA-CCCTGCGGGGCTGCCCGATATGTGTCCAGGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 110 ± 3 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0930 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer11 | GGGAGCTCAGAATAAACGCTCAA-GGCACGATGTGGCTACATCGATCGCGGTACTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 103 ± 4 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0931 | 28689112 | 2017 | Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor | Aptamer12 | GGGAGCTCAGAATAAACGCTCAA-GGGGAGGCAGTGTGTTGTGTCGTGTGTGTGCTTGG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify an aptamer against H37Rv and develop a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor to distinguish it from M. smegmatis and BCG strain. | N/A | 14 | Fluorescence Spectroscopy | 110 ± 7 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0948 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0949 | 28414975 | 2017 | Fullerene-doped polyaniline as new redox nanoprobe and catalyst in electrochemical aptasensor for ultrasensitive detection of Mycobacterium tuberculosis MPT64 antigen in human serum | MBA II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Electrochemical aptasensor based on GNPs-C60-PAn labelled with signal aptamer for the determination of MTB antigen. | A wide linear detection range of 0.02 to 1000 pg/mL was obtained, with a detection limit of 20 fg/mL for MPT64. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0952 | https://doi.org/10.1016/j.foodcont.2017.07.016 | 2017 | SERS aptasensor for Salmonella typhimurium detection based on spiny gold nanoparticles | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a novel SGNPs-based SERS aptasensor functionalized with p-MBA for the detection of S. typhimurium. | Display linear range 10(1) cfu/mL to 10(5) cfu/mL, with a limit of detection (LOD) of 4 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated or Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0965 | 28287715 | 2017 | Dual-Recognition Förster Resonance Energy Transfer Based Platform for One-Step Sensitive Detection of Pathogenic Bacteria Using Fluorescent Vancomycin-Gold Nanoclusters and Aptamer-Gold Nanoparticles | Aptamer | GCAATGGTACGGTACTTCC-TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Bacterial cell wall | Develop a dual-molecular FRET platform based on the recognition of bacterial cell walls by antibiotic and aptamer molecules, respectively, for the detection of pathogenic bacteria. | Shows a linear concentration of Staph. aureus in the range from 20 to 10(8) cfu/mL with a detection limit of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0997 | https://doi.org/10.1007/s12161-017-0864-8 | 2017 | Fabricating a Novel Raman Spectroscopy-Based Aptasensor for Rapidly Sensing Salmonella typhimurium | S. typhimurium aptamer (STA) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a surface-enhanced Raman scattering (SERS) based aptasensor with Raman active molecule attached GNRs and cDNA for the detection of Salmonella typhimurium (ST). | Observed linear ST concentration from 56 to 56 × 10(7) cfu/mL with a LOD of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1066 | 29896641 | 2018 | Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Develop SERS-based aptasensor using DNA-assembled gold nanodimers (AuNDs) for detection of S. typhimurium. | Display a linear range in the 10(2) to 10(7) cfu/mL, and the limit of detection is 35 cfu/mL within 1hr. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1084 | 29729642 | 2018 | Design and fabrication of an electrochemical aptasensor using Au nanoparticles/carbon nanoparticles/cellulose nanofibers nanocomposite for rapid and sensitive detection of Staphylococcus aureus | Staphylococcus aureus aptamer | TCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 46 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an impedimetric aptasensor using AuNPs/CNPs/CNFs nanocomposites for the rapid detection of S. aureus. | Exhibited a wide linear dynamic range 1.2 × 10(1) to 1.2 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1094 | 30413894 | 2018 | An impedimetric aptasensor for Shigella dysenteriae using a gold nanoparticle-modified glassy carbon electrode | Aptamer | ATAGGAGTCACGACGACCAGAACGGAACTAGCGTTTAAATGCCAGGACTGAAGTAGGCAGGGATTAGTCAAGAGGTAGACGCACATA | 87 | N/A | ssDNA | Shigella Dysenteriae (PTCC 1188) | Outer membrane protein (OMP) | Developed an impedimetric aptasensor using GCE modified with AuNPs for the detection of S. dysenteriae. | Display linear dynamic range that extends from 10(1) to 10(6) CFU/mL and a limit of detection of 100 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1191 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-I | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy employing an ultrasensitive aptasensor for the voltammetric determination of M. tuberculosis. antigen MPT64 in human serum. | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1192 | 30421038 | 2018 | Dual-aptamer-based voltammetric biosensor for the Mycobacterium tuberculosis antigen MPT64 by using a gold electrode modified with a peroxidase loaded composite consisting of gold nanoparticles and a Zr(IV)/terephthalate metal-organic framework | APT-II | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | A sandwich-like dual-aptamer strategy where two different aptamers are immobilized on a gold electrode to synergistically bind the target MPT64 protein | Achieved an ultrasensitive detection limit of 10 fg/mL and a wide linear response range from 0.02 to 1000 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1195 | 30019137 | 2018 | Aptamer based voltammetric biosensor for Mycobacterium tuberculosis antigen ESAT-6 using a nanohybrid material composed of reduced graphene oxide and a metal-organic framework | ESAT-6 binding aptamer (EBA) | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Develop a voltammetric aptasensor employing P-MOF-rGO nanohybrid as the sensitive sensing platform for ultrasensitive detection of ESAT-6. | Linear range: 1.0×10(−4) to 2.0×10(2) ng/mL and Limit of Detection (LOD): 3.3×10(−5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Compared with the initial current response, the aptsensor response decreased only about 3.5% after 50 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1198 | 30359519 | 2018 | Ω-Shaped Fiber-Optic Probe-Based Localized Surface Plasmon Resonance Biosensor for Real-Time Detection of Salmonella Typhimurium | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-immobilized Ω-shaped fiber-optic localized surface plasmon resonance (FOLSPR) biosensor for S. Typhimurium detection. | Achieved high detection sensitivity for S. Typhimurium down to 128 CFU/mL within a linear range from 5 × 10(2) to 1 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1199 | https://doi.org/10.1016/j.snb.2017.08.160 | 2018 | Nanoporous gold as a suitable substrate for preparation of a new sensitive electrochemical aptasensor for detection of Salmonella typhimurium | Anti-S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed a label-free electrochemical aptasensor based on nanoporous gold (NPG/Au/GCE) for the detection of Salmonella typhimurium. | Capable of detecting S. typhimurium in a wide linear dynamic range 6.5 × 10(2) to 6.5 × 10(8) CFU/mL with a LOD of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1228 | 31183576 | 2019 | Surface-enhanced Raman spectroscopic single step detection of Vibrio parahaemolyticus using gold coated polydimethylsiloxane as the active substrate and aptamer modified gold nanoparticles | V.P. Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Aptamer-based SERS method using Au-PDMS film for the detection of V. parahaemolyticus. | The detection limit is 12 cfu/mL with a wide linear range from 1.2 × 10(2) to 1.2 × 10(6) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1325 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅰ (MAA Ⅰ) | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | 35 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1326 | 31202103 | 2019 | A sandwich-type electrochemical aptasensor for Mycobacterium tuberculosis MPT64 antigen detection using C60NPs decorated N-CNTs/GO nanocomposite coupled with conductive PEI-functionalized metal-organic framework | MPT64 antigen aptamer Ⅱ (MAA Ⅱ) | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | 34 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop a sandwich-type electrochemical aptasensor using (C60NPs-N-CNTs/GO) for the detection of MPT64 antigen. | Showed a wide linear range from 1 fg/mL to 1 ng/mL with a limit of detection (LOD) as low as 0.33 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | Oxidation current remains 94.5% of the initial level after 80 cycles, and peak current remains approximately 98.7%, 93.5%, and 90.6% of the initial peak current after 7, 14, and 21 days, respectively. | N/A | N/A | N/A |
| ABdb_1327 | 31446952 | 2019 | Aptamer-based SERS biosensor for whole cell analytical detection of E. coli O157:H7 | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | SERS-based aptasensor using 4-aminothiophenol-gold nanoparticle complexes was developed for the detection of E. coli O157:H7. | Low concentrations of E. coli O157:H7 were detected and quantified within 20 min in both pure culture (∼10(1) CFU/mL) and ground beef samples (∼10(2) CFU/mL), and a linear range from 10(2) to 10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1329 | 31410576 | 2019 | Electrochemical determination of Salmonella typhimurium by using aptamer-loaded gold nanoparticles and a composite prepared from a metal-organic framework (type UiO-67) and graphene | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | An aptamer-based assay based on a metal-organic framework-graphene composite of type UiO-67/GR and an aptamer-gold nanoparticles-horseradish peroxidase (Apt-AuNP-HRP) conjugate is described for the determination of S.typhimurium. | Linear detection range from 2 × 10(1) – 2 × 10(8) cfu/mL and a lower detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | 91.3% of the original current is retained after storage at 4°C for 14 days with the modified electrodes, allowing monitoring of 2 × 10(5) cfu/mL S. typhimurium. | N/A | N/A | N/A |
| ABdb_1339 | 30522085 | 2019 | A label-free impedimetric aptasensor for the detection of Bacillus anthracis spore simulant | BAS-6R | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus (ATCC 11778 and ATCC 14579) | B. anthracis spore simulant (B. cereus spore 14579) | Developed an impedimetric DNA-based aptasensor based on an aptamer immolized on a gold screen-printed electrode for a single-step detection of B. cereus spores. | Spores were detected with a linear range between 10(4) CFU/ml and 5 × 10(6) CFU/ml and a detection limit of 3 × 10(3) CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1412 | https://doi.org/10.1111/jfs.12868 | 2020 | Ultrasensitive detection of Listeria monocytogenes using solid-state electrochemiluminescence biosensing based on the quenching effect of ferrocene on ruthenium pyridine | Aptamer (ssDNA) | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115, Serotype 4 b) | Whole cell | Developed an ECL biosensing switch system based on the specific recognition of an aptamer and the destruction of pyridine ruthenium by ferrocene for the detection of L. monocytogenes. | Produced a good linear relationship over the concentration range of 1.4 × 10(1)–1.4 × 10(6) CFU/ml and a detection limit of 4 CFU/ml. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1439 | 31726272 | 2020 | CdS quantum dots/Au nanoparticles/ZnO nanowire array for self-powered photoelectrochemical detection of Escherichia coli O157:H7 | E. coli aptamer | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Surface protein | Developed a photoelectrochemical (PEC) platform (CdS QDs/Au NPs/ZnO NWs) for the detection of E. coli O157:H7. | Exhibited a wide linear range of 10-10(7) CFU/mL with the detection limit as low as 1.125 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 15 days, the PEC aptasensor still retained 87% of its initial sensitivity. | N/A | N/A | N/A |
| ABdb_1500 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 1 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 18 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1501 | 32000058 | 2020 | A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate | Apt 2 | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a SERS aptasensor using Apt-Au-PDMS film for simultaneous multiple-pathogen detection. | Can selectively detect 27 cfu/mL cells. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1545 | https://doi.org/10.1016/j.electacta.2021.139633 | 2021 | A new electrochemical aptasensor based on gold/nitrogen-doped carbon nano-onions for the detection of Staphylococcus aureus | Anti-S. aureus aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an electrochemical aptasensor based on SPEs modified with AuNPs and NCNOs for the detection of S. aureus. | Measured S. aureus quickly with a limit of detection of 3 CFU/mL in the linear range of 10–10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1554 | 34940268 | 2021 | One-Step Fabrication of Stimuli-Responsive Chitosan-Platinum Brushes for Listeria monocytogenes Detection | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 15313) | Internalin A (InlA) | Developed a label-free electrochemical biosensor using a new one-step simultaneous sonoelectrodeposition of platinum and chitosan (CHI/Pt) to create a biomimetic nanostructure for Listeria monocytogenes detection. | LOD of the CHI/Pt-aptamer brushes in PBS was 2.5 ± 0.3 CFU/mL, 3.3 ± 0.9 CFU/mL in chicken broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1582 | https://doi.org/10.1016/j.microc.2021.106132 | 2021 | A novel photoelectrochemical aptamer sensor based on rare-earth doped Bi2WO6 and Ag2S for the rapid detection of Vibrio parahaemolyticus | Aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a novel photoelectrochemical aptasensor based on rare-earth doped Bi2WO6 and Ag2S for the detection of V. parahaemolyticus. | Showed a wide linear range from 3.2 × 10(2) CFU/mL to 3.2 × 10(8) CFU/mL, and a detection limit of 40 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | After 2 weeks of storage at 4°C in a refrigerator, the biosensor retained 95% of its initial response. | N/A | N/A | N/A |
| ABdb_1584 | 34053767 | 2021 | A novel smartphone-based colorimetric aptasensor for on-site detection of Escherichia coli O157:H7 in milk | Aptamer (Apt) | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | A colorimetric aptasensor was developed using GNP-Apt coupling with an MWCNT@CIP probe for detecting E. coli O157:H7 in milk. | Display a concentration of 8.43 × 10(3) cfu/mL in pure culture, and 5.24 × 10(2) cfu/mL in artificially contaminated milk after 1h. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1586 | 34074432 | 2021 | One-step colorimetric detection of Staphylococcus aureus based on target-induced shielding against the peroxidase mimicking activity of aptamer-functionalized gold-coated iron oxide nanocomposites | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric sensor using apt-Fe3O4/Au nanocomposites for the detection of Staphylococcus aureus. | Display a linear range from 10 to 10(6) CFU/mL, with the visible limit of detection as low as 10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1598 | 10.33263/BRIAC112.87028715 | 2021 | Novel Competitive Voltammetric Aptasensor Based on Electrospun Carbon Nanofibers-Gold Nanoparticles Modified Graphite Electrode for Salmonella enterica serovar Detection | Aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor based on aptamer-linked GNPs/CNF-Chi/GEs for the detection of Salmonella enterica Serovar. | Exhibited a linear range of 10 to 10(5) CFU/mL with the limit of detection (LOD) 1.223 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1606 | https://doi.org/10.1016/j.snb.2020.129100 | 2021 | Naked eye colorimetric detection of Escherichia coli using aptamer conjugated graphene oxide enclosed Gold nanoparticles | E8 | TAGGGAAGAGAAGGACATATGA-CATTCTGCACCGCCATCAGTCTTTCTTCGATACCGCGTTT-TTGACTAGTACATGACCACTTGA | 85 | 5'-TAGGGAAGAGAAGGACATATGA-46N-TTGACTAGTACATGACCACTTGA-3' | ssDNA | Escherichia Coli (E. Coli) (MTCC no.1698) | Whole cell | Identify an aptamer against E.coli and develop a detection platform using gold nanoparticles and graphene oxide with aptamer conjugation. | The limit of detection observed visually was 10(2) cells/mL with GO coating and 10(3) cells/mL without GO. The detection limit in real-time coconut water samples was also 10(2) cells/mL. | 7 | Fluorescence Microplate Reader (Fluorescence Spectroscopy) | 15.90 ± 3.07 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled, 5'-Thiolated and 5'-Amidation (NH₂) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1650 | 35869107 | 2022 | An innovative dual recognition aptasensor for specific detection of Staphylococcus aureus based on Au/Fe3O4 binary hybrid | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed an imprinted aptasensor (apt-AuNPs@ Fe3O4) for the quantification of S. aureus. | Exhibited a wide linear range of 10(1)-10(7) CFU/mL with a Limit of Detection (LOD ) of 1 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | The aptasensor retained approximately 95% of its original activity for four weeks. | N/A | N/A | N/A |
| ABdb_1652 | 35870283 | 2022 | An ultrasensitive and dual-recognition SERS biosensor based on Fe3O4@Au-Teicoplanin and aptamer functionalized Au@Ag nanoparticles for detection of Staphylococcus aureus | S. aureus Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | The SERS biosensor based on Fe3O4@Au-Tcp NPs as a capture probe and Au@Ag-DTNB-Apt NPs as a signal probe for the detection of S. aureus. | Showed detection limit of 1.09 CFU/mL with a broad dynamic linear range of 7.6 × 10(1)-7.6 × 10(7) CFU/mL within 50 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1679 | 35031253 | 2022 | Architecting of an aptasensor for the staphylococcus aureus analysis by modification of the screen-printed carbon electrode with aptamer/Ag-Cs-Gr QDs/NTiO2 | Aptamer | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | An electrochemical aptasensor employing Apt/Ag–Cs-Gr QDs/NTiO2/SPCE was developed for the detection of S. aureus. | Limit of Detection (LOD) of 3.3 CFU/mL and dynamic range of 10–5 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | Compared with the initial current response, the aptsensor response changed less than 10% after 100 cycles’ continuous CV scans. | N/A | N/A | N/A |
| ABdb_1746 | https://doi.org/10.1016/j.snb.2021.130879 | 2022 | Aptamer-conjugated magnetic Fe3O4@Au core-shell multifunctional nanoprobe: A three-in-one aptasensor for selective capture, sensitive SERS detection and efficient near-infrared light triggered photothermal therapy of Staphylococcus aureus | Apt | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | Developed an aptasensor based on Fe3O4@Au nanocomposites (NCs) for capture, SERS detection, and photothermal therapy (PTT) of S. aureus. | The detection limit is 25 cfu/mL, the cell capture efficiency (CCE) is as high as 68% and it has a high photothermal conversion efficiency of 39.28%. | N/A | N/A | N/A | Diagnostic/Therapeutics | N/A | 5'-Thiolated | The cytotoxicity of Fe3O4@Au-Apt NCs to S. aureus is negligible. | The SERS intensity of S. aureus on the Fe3O4@Au-Apt NCs remains almost unchanged within 12 days. | N/A | N/A | N/A |
| ABdb_1771 | https://doi.org/10.1016/j.colsurfa.2023.131955 | 2023 | MoS2 nanosheets based label-free colorimetric aptasensor for Escherichia coli O157: H7 detection | Aptamer | ATCCGTCACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed colorimetric aptasensor based on aptamer-functionalized MoS2 nanosheets for the detection of E. coli O157: H7. | Detection of E. coli O157: H7 with a Limit of detection (LOD) of 116 CFU/mL and a linear concentration range of 500–5000 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1773 | 37921634 | 2023 | Aptamer and DNAzyme-Functionalized Cu-MOF Hybrid Nanozymes for the Monitoring and Management of Bacteria-Infected Wounds | Aptamer | GGGAAAGGGAAAGGGAAAGGG-TTTTTT-ATCCAGACGTGACGCAGCATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTGTGGACACGGTGGCTTAGTA | 102 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | MRSA surface components | G-quadruplex/hemin DNAzyme-aptamer probes and tannic acid-chelated Au nanoparticle (Au-TA)-decorated Cu-based MOF nanosheets (termed GATC) with triple-enzyme activities were developed for visual detection and efficient antibacterial therapy. | ~99.7% MRSA inactivation at 3 μg/mL, with simultaneous colorimetric monitoring of infection. | N/A | N/A | N/A | Therapeutics | N/A | 5'-Thiolated | At 50 μg/mL GATC, the cells showed high viability (>90%), indicating negligible cytotoxicity and good cytocompatibility. The hemolysis rate of the GATC nanozyme was low (<5%). | N/A | N/A | N/A | N/A |
| ABdb_1774 | 37244192 | 2023 | High-throughput, highly sensitive and rapid SERS detection of Escherichia coli O157:H7 using aptamer-modified Au@macroporous silica magnetic photonic microsphere array | Aptamer | TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | An aptamer-Au@MMSPM SERS array biochip method was developed for the detection of E. coli O157:H7. | Gave a wide linear detection range (10–10(6) CFU/mL) and low limit of detection (2.20 CFU/mL) for E. coli O157:H7. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (SH-C12) (of Aptamer 1) and 3'-Amidation (NH₂-(CH2)6) (for Aptamer 2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1776 | 36906992 | 2023 | An ultrasensitive electrochemical aptasensor using Tyramide-assisted enzyme multiplication for the detection of Staphylococcus aureus | SA37 | GCTTCCAGCTTATTGAATAAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGGGCGCTGAAGCGCGGAAGC | 76 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | An electrochemical aptasensor based on the tyramide signal amplification (TSA) technology was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 3 CFU/mL in buffer and 8 CFU/mL in both tap water and beef broth. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1777 | 36832038 | 2023 | Applicability of a Green Nanocomposite Consisted of Spongin Decorated Cu2WO4(OH)2 and AgNPs as a High-Performance Aptasensing Platform in Staphylococcus aureus Detection | Apt | TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC | 43 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensing Platform based on a Green Nanocomposite consisting of Spongin Decorated Cu2WO4(OH)2 and AgNPs for Staphylococcus aureus detection. | Measured S. aureus under a linear concentration range of 10–10(8) CFU/mL and a limit of quantification and detection of 12 and 1 CFU/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1782 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt1 | GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Escherichia Coli (E. Coli) (ATCC 25922) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for E. coli was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1783 | 36549213 | 2023 | Ultrasensitive dual-enhanced sandwich strategy for simultaneous detection of Escherichia coli and Staphylococcus aureus based on optimized aptamers-functionalized magnetic capture probes and graphene oxide-Au nanostars SERS tags | Apt2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC 26003) | Whole cell | A SERS platform using aptamers modified-Fe3O4@SiO2-Au NCs was developed for simultaneous detection of E. coli and S. aureus. | The detection limit for S. aureus was as low as 10 cfu/mL, and the linear concentration ranged from 10(1)-10(8) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂) or 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1807 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B15 | AGCAGCACAGAGGTCAGATG-GGCGGGTTTGGATCTTTGGTTGGCGCCTGTTTCTTTATGA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 16.13 ± 4.98 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1808 | https://doi.org/10.1016/j.aac.2023.07.005 | 2023 | DNA aptamers selection and characterization for development of impedimetric aptasensor for Bacillus cereus at different growing stages | B16 | AGCAGCACAGAGGTCAGATG-ATATGTTTACGCCAGTGGTATTATTGGGGTTGATATGTCA-CCTATGCGTGCTACCGTGAA | 80 | 5'-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3' | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | Identify aptamers against B. cereus across different growth phases and develop an impedance-based aptasensor immobilized on a GCE/Au surface for its detection. | Achieve highly sensitive detection of B. cereus as low as 10 cfu/mL. | 16 | Flow Cytometry | 20.67 ± 5.23 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1817 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CICC 10473) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 5.70 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1818 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | E. coli aptamer | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.10 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1819 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. flexneri aptamer | CAGCAACACTGCAACACTGTATAGTCCTGTGTGCC | 35 | N/A | ssDNA | Shigella Flexneri (CGMCC 1.1868) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.72 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1820 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (CICC 21636) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.84 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1821 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 2.27 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1822 | 36705734 | 2023 | A universal approach for sensitive and rapid detection of different pathogenic bacteria based on aptasensor-assisted SERS technique | L. monocytogenes aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Monocytogenes (CICC 21635) | Whole cell | Developed an assembled aptasensor based on Fe3O4@Au@Ag nanocomposites for the detection of various pathogenic bacteria. | Showed a linear range of 10-10(7) CFU/mL, with a detection limit of 3.16 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1824 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | S. aureus aptamer (P1) | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (BNCC 186335) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect S. aureus with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1825 | https://doi.org/10.1016/j.microc.2023.108605 | 2023 | A SERS biosensor based on aptamer-based Fe3O4@SiO2@Ag magnetic recognition and embedded SERS probes for ultrasensitive simultaneous detection of Staphylococcus aureus and Escherichia coli | E. coli aptamer (P2) | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (BNCC 336902) | Whole cell | Developed a SERS biosensor based on aptamer-modified Fe3O4@SiO2@Ag and Au-MPBA/DTNB@Ag for simultaneous detection of S.aureus and E.coli. | Rapidly detect E. coli with the limit of detection (LOD) of 1 CFU/mL in 20 min and a linear range from 10(1) ∼ 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1832 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-19 | TCCCTACGGCGCTAAC-GACATGATGGTGCCAAACAACATTCGGAAAGCCTGACCGT-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | Limit of Detection (LOD): 4.6 CFU/mL and linear trend ranging from 10 to 10(8) CFU/mL. | 10 | Fluorescence Binding Assay | 14.19 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1833 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-3 | TCCCTACGGCGCTAAC-TGGCAAATAATGCAATTGAAGAAAGCCCCCCCCTGCCCGA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 15.61 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1834 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-29 | TCCCTACGGCGCTAAC-TGTGAAACAAGGCAAGGGAACTGACGTCATAAGGATAGCA-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.38 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1835 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-37 | TCCCTACGGCGCTAAC-AAGATGAAAGACGACCGGACAGTACATATAGCGCTCTCGC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 17.96 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1836 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-31 | TCCCTACGGCGCTAAC-ACCTGCAGTAGGGAATGCGAATGATGAGACGCCTGATTGG-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 68.83 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1837 | 38898115 | 2024 | Cell-SELEX for aptamer discovery and its utilization in constructing electrochemical biosensor for rapid and highly sensitive detection of Legionella pneumophila serogroup 1 | AY-24 | TCCCTACGGCGCTAAC-ACAGACAGAATGAGTGAACATAGGCCAATAACGCACGTCC-CCACCGTGCTACAAC | 71 | 5'-TCCCTACGGCGCTAAC-N40-CCACCGTGCTACAAC-3' | ssDNA | Legionella Pneumophila serogroup 1 (L. pneumophila SG1) (ATCC 33152) | Whole cell | Identify an aptamer against L. pneumophila SG1 and develop an electrochemical aptasensor for its detection. | N/A | 10 | Fluorescence Binding Assay | 75.24 nM | Detection | Whole Cell-SELEX | 5'-Thiolated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1844 | 38150965 | 2024 | Colourimetric and SERS dual-mode aptasensor using Au@Ag and magnetic nanoparticles for the detection of Campylobacter jejuni | ONS-23 | GCAAGATCTCCGAGATATCGTGCTGGGGGGTGGTTTGTTTGGGTCGGTTGTTTTGGTTGGGCTGCAGGTAATACGTATACT | 81 | N/A | ssDNA | Campylobacter Jejuni (ATCC 33291) | Whole cell | Developed a dual-mode aptasensor using aptamer-conjugated Au@Ag NPs for the effective detection of C. jejuni. | Exhibit a wider linear range (1.8 × 10(1)–10(8) CFU/mL and a lower limit of detection of 6 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt-1) and 5′–NH2 (for apt-2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1871 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. enterica aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. enterica at a limit of detection (LOD) as low as 1 CFU in PBS buffer with a linear range from 62.5–6.4 × 10(4) CFU/mL. | N/A | Flow Cytometry | 8.9 ± 2.0 nM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1872 | 38669846 | 2024 | Ultra-sensitive and rapid detection of Salmonella enterica and Staphylococcus aureus to single-cell level by aptamer-functionalized carbon nanotube field-effect transistor biosensors | S. aureus aptamer | AACGAGGCGCAGGGGGAGGGGGTGGTACAGATAAGATGGGG | 41 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (CMCC(B) 26003) | Whole cell | Developed an aptamer-functionalized CNT-FET biosensor for the detection of these foodborne pathogens. | Could detect S. aureus at a limit of detection (LOD) as low as 1.2 CFU in PBS buffer with a linear range from 10(2)-1.28 × 10(4) CFU/mL. | N/A | Flow Cytometry | 0.65 ± 0.2 μM | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6), 5'-FAM Labeled and 3'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1893 | 41245639 | 2025 | Simultaneous and sensitive detection of Mycobacterium tuberculosis and SARS-CoV-2 antigens employing an electrochemical impedance spectroscopy aptasensor | MPT64 aptamer sequence (17) | GTCAACAGTCCAGTTGGGAGGTCGCTTATAGCTGCTTGTC | 40 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an EIS-based aptasensor fabricated to detect MPT64 and S-glycoprotein simultaneously, employing a dual-platform approach on a screen-printed gold electrode (SPGE). | Achieved detection limits of 0.053 pg/mL in buffer and in human serum of 0.085 pg/mL with a linear range of 0.01 pg/mL to 10 pg/mL in both buffer and human serum. | N/A | N/A | 8.92 nM | Biosensor | N/A | 5'-Thiolated (HS(CH2)6-(CH2CH2O)6-TTTTT) | N/A | The aptasensor maintained good storage stability for up to 22 days. | N/A | N/A | N/A |
| ABdb_1894 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | LPS Aptamer | TAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCA | 45 | N/A | ssDNA | Escherichia Coli (E. Coli) DH5α | Lipopolysaccharide (LPS) | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect E. coli with a limit of detection of 2 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1895 | 39793372 | 2025 | Aptamer-molecularly imprinted polymer sensors for the detection of bacteria in water | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) strain SH1000 | Whole cell | Developed an electrochemical sensor based on aptamer-molecularly imprinted polymer (Apta-MIP) for the multiplexed detection of Staphylococcus aureus and Escherichia coli. | Can detect S. aureus with a limit of detection of 4 CFU/mL and exhibited a broad dynamic range from 1 CFU/mL to 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (HS-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1922 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss1 | TGACTGACGACGACTC-CCCGCAGGGGATCCGGATGCCGCGTTGGAGGAGATATGTATTATTCCATC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | Demonstrated a linear response across a range of 10–10(8) CFU/mL for P. micra with a limit of detection of 11 CFU/mL. | 17 | Fluorescence Binding Assay | 33.84 ± 0.92 nM | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1923 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss2 | TGACTGACGACGACTC-GGAGAACTACCGCACCAACAATTCACCGTCTGGACGTTCTGCCCTCTCCC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1924 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss8 | TGACTGACGACGACTC-GGGAGGTCAGACTATCTTGTTCCTCCTGGAGGTCGGGAAGAGAGTTGACG-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1925 | 39905704 | 2025 | Au@Fe3O4 Nanoparticle-Based Colorimetric Aptasensor for Noninvasive Screening of Colorectal Cancer via Detection of Parvimonas micra | Apt-ss9 | TGACTGACGACGACTC-GGGGGCTGTCAAAAATTACTCTTGGGCCCAGCAATGGTAATTTTCTGACC-GACTGCTCGAGCTG | 80 | 5'-TGACTGACGACGACTC-N50-GACTGCTCGAGCTG-3' | ssDNA | Parvimonas Micra (ATCC 33270) | Whole cell | Isolate aptamers against P. micra and develop colorimetric aptsensor using Au@Fe3O4 nanoparticles. | N/A | 17 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Thiolated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1945 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt1 & Apt3 | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTATTTTTTTTTT | 81 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 16 CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1946 | 41344010 | 2026 | SERS-based Aptasensor using Au NSs@Ag NPs/magnetic graphene oxide assemblies for simultaneous detection of Escherichia coli and Staphylococcus aureus | Apt2 & Apt4 | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAACTTTTTTTTT | 71 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SERS aptasensor based on aptamer-magnetic graphene oxide (MGO) and dual-functional Au NSs@Ag NPs probes for simultaneous detection of E. coli and S. aureus. | The SERS intensity shows a good linear relationship over a range of 50 to 10(6) CFU/mL, with a detection limit of 20 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for apt1 & apt2) and 5'-Amidation (NH₂) (for apt3 & apt4) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2119 | 30245324 | 2018 | Aptamer functionalized MoS2-rGO nanocomposite based biosensor for the detection of Vi antigen | Anti-Vi aptamers population | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Salmonella Typhi | Vi polysaccharide antigen (Vi antigen) | Developed a novel aptamer functionalized MoS2-rGO-based electrochemical aptasensor for Vi polysaccharide antigen-mediated detection of enteric fever. | Responded linearly in the range between 0.1 ng/mL to 1000 ng/mL with a detection limit of 100 pg/mL. | 6 | Saturation Binding Assay | 638.6 nM | Biosensor | SELEX | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2121 | 31700125 | 2019 | An aptasensor for the detection of Mycobacterium tuberculosis secreted immunogenic protein MPT64 in clinical samples towards tuberculosis detection | Aptamer | N/A | N/A | N/A | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 protein | Electrochemical impedance spectroscopy (EIS) aptasenosor based on an IDE for the detection of MPT64. | Display LOD of 4.1 fM and the specificity and sensitivity for the sputum sample analysis 100% and 76.47%, respectively, and for the serum sample analysis 100% and 88.24%, respectively. | N/A | N/A | 8.92 nM | Biosensor | N/A | 5'-Thiolated (HS-(CH6)6-OP(O)2O-(CH2CH2O)6-5′-TTTTT) | N/A | N/A | N/A | N/A | N/A |
| ABdb_2122 | 33367418 | 2021 | Photo-responsive functional gold nanocapsules for inactivation of community-acquired, highly virulent, multidrug-resistant MRSA | Aptamer | N/A | N/A | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) “superbug” (USA300) | Whole cell | Aptamers functionalization of Cur@mPEG-SH@GNRs for PTT and ROS. | Blocked biofilm formation and killed all of the trapped bacteria in 30 min during NIR stimulation. | N/A | N/A | N/A | Targeted Delivery/Therapeutics | N/A | 5'-Thiolated | N/A | N/A | N/A | N/A | N/A |