Modification : 5'-TYE 665 dye and 3'-Iowa Black end labels

Total records found: 2

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0134	22218972	2012	Development of aptamer beacons for rapid presumptive detection of Bacillus spores	BAS-6F	ATACGGGAGCCAACACCATCCCTCTTAGGATACAAAGCCAAACTGAGCCCGTGCAGAGCAGGTGTGACGGAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Bacillus Anthracis (BA) (nonpathogenic Sterne strain)	Anthrose and Whole B. anthracis spores	Aptamer beacon that specifically binds to the Bacillus spores.	Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml.	5	N/A	N/A	Biosensor	Magnetic Bead (MB)-based SELEX	5'-TYE 665 dye and 3'-Iowa Black end labels	N/A	N/A	N/A	N/A	N/A
ABdb_0135	22218972	2012	Development of aptamer beacons for rapid presumptive detection of Bacillus spores	BAS-6R	ATCCGTCACACCTGCTCT-GCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGGA-TGGTGTTGGCTCCCGTAT	72	5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3'	ssDNA	Bacillus Anthracis (BA) (nonpathogenic Sterne strain)	Anthrose and Whole B. anthracis spores	Aptamer beacon that specifically binds to the Bacillus spores.	Limit of detection (LOD) of approximately 30,000 to 60,000 B. anthracis spores per ml.	5	N/A	N/A	Biosensor	Magnetic Bead (MB)-based SELEX	5'-TYE 665 dye and 3'-Iowa Black end labels	N/A	N/A	N/A	N/A	N/A