Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 20
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0009 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F1-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-ACUGUCCUCCCUUCAGAGAGCGCGGGACCCUUAACUUGGGGCCCACGAACAGCUUCAGUUCCGUCUCGGCGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 140 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F1-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 2 ± 11 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0010 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F2-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-UCCCUGGCCCAAGAUCCUAAUAAAGUUUUUUCGGACCGGAGCGAAACCACUAUCCUCUUAAGCAAUCUGU-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | Addition of aptamer F2-1 in a 1000-fold excess over the colicin E3 CRD completely restored protein synthesis. | 12 | Nitrocellulose Filter Binding Assay | 14 ± 2 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0011 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F3-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUACAACACAUCAUUACGGCUGCUAUUGGCUCCAAGCGUCUUUCUCCCUGGUCAAUAGUCCAGCCACCACG-CAUAUGUGCGUCUACAUGGAUCCUCA | 139 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 4 ± 15 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0012 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGAGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 7 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0013 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F5-1 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GUCAGCUGCUCGCGGGAUCGAUCCAUUCGGUGGCCAUGCUCCGGAAGAGGCUUCGCAAGACUCAGG-CAUAUGUGCGUCUACAUGGAUCCUCA | 134 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 10 ± 1 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0014 | 15023071 | 2004 | In vitro selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA | F4-2 | GGUAAUACGACUCACUAUAGGGAGAAUUCCGACCAGAAGCUU-GACAUCUGUAAGUAAGAUUCUAUCUGCAAAGCGGUUAGGGGGGCUCGGACUCUGAUUGCCUCCCCGCACC-CAUAUGUGCGUCUACAUGGAUCCUCA | 138 | 5'-GGTAATACGACTCACTATAGGGAGAATTCCGACCAGAAGCTT-N72-CATATGTGCGTCTACATGGATCCTCA-3' | ssRNA | Escherichia Coli (E. Coli) | C-terminal ribonuclease domain of Colicin E3 | Identify aptamers that bind to colicin E3 CRD and inhibit the nuclease activity. | N/A | 12 | Nitrocellulose Filter Binding Assay | 294 ± 170 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0015 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.4 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UCACUGUUAUCCGAUAGCAGCGCGGGAUGA-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | 2.0 μg of RNA aptamer S-PS8.4 effected ca. 71% inhibition of cell invasion by pil+ S. enterica serovar Typhi A21-6 but only ca. 19% inhibition in the case of the pilS::Kmr mutant. | 8 | Nitrocellulose Filter Binding Assay | 8.56 nM | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0016 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.3 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AUUACCUAGAGCGGGAUAAAGUAUAGGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0017 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.2 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-CAUCGAGGAGGCGGGAUAUUCGAUGAGUU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0018 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.5 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAGUACGAGCGGGAUAGUAAUCGGGUGAU-GGGUCAAUGCGUCAUA | 87 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0019 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.6 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-GAAGGGGUCCGGCUCGGGUGAGGGUCGGGU-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0020 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.9 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AGCUAGCGGGGGGGCUCGACGGUGGUGGGUU-GGGUCAAUGCGUCAUA | 89 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0021 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.7 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UAGCGGGAGCUUGGACCUGGUGGUCGCGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0022 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.1 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-UUGGGAUCAGCUCGGCGCUGGAGGAGGGGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0023 | 16189080 | 2005 | Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovar typhi | S-PS8.8 | GCGGAAUUCUAAUACGACUCACUAUAGGGAACAGUCCGAGCC-AACUGUACAUGGGCGCAACAGGGAGUUAGC-GGGUCAAUGCGUCAUA | 88 | 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N30-GGGTCAATGCGTCATA-3' | ssRNA | Salmonella Typhi | Type IVB Pili structural proteins | Identify an aptamer that binds to type IVB pili and inhibits the entry of the piliated strain (but not that of the nonpiliated strain) into human THP-1 cells. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Therapeutics | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0356 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac1 | TCGCGCGAGTCGTCTG-GGGACAGGGAGTGCGCTGCTCCCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac1 was 28 times higher than the negative control. | 5 | Saturation Binding Assay | 0.415 + 0.047 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0357 | 25185503 | 2014 | Selection of peptidoglycan-specific aptamers for bacterial cells identification | Antibac2 | TCGCGCGAGTCGTCTG-GGGGACTAGAGGACTTGTGCGGCC-CCGCATCGTCCTCCC | 55 | 5'-TCGCGCGAGTCGTCTG-N24-CCGCATCGTCCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) and Escherichia Coli (E. Coli) TOP10 | Peptidoglycan | Identify aptamers that bind to the peptidoglycan of bacterial cells. | High binding affinity for S. aureus, as the radioactivity of Antibac2 was 22 times higher than the negative control. | 5 | Saturation Binding Assay | 1.261 + 0.280 μM | Detection | SELEX | 5'-Radiolabelled (32P-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0696 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA20 | GCAATGGTACGGTACTTCC-GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 70.86 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0697 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA23 | GCAATGGTACGGTACTTCC-GGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCA-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 61.50 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |
| ABdb_0698 | 25533762 | 2015 | Identification of Staphylococcus aureus infection by aptamers directly radiolabeled with technetium-99m | SA34 | GCAATGGTACGGTACTTCC-CACAGTCACTCAGACGGCCGCTATTGTTGCCAGATTGCCTTTGGC-CAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | 99mTc-labelled aptamers for bacterial infection identification. | EC50 value of 99mTc labelled aptamer was 72.42 nM and displayed a target/non-target ratio of 4.0±0.5. | N/A | Radiolabeled Binding assay | N/A | Diagnostic | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Radiolabelled (32P-labeled) | N/A | Radiolabeled aptamers with 99mTc were stable in 0.9% saline solution, in plasma, and in the presence of excess cysteine (50-, 500-, and 5000-fold), even for long period of 24hr. | N/A | N/A | N/A |