Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1206 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G1-T1 | TAGGAGGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAGTCGCACTGCTCCTG | 59 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | Achieved a detection limit of 1 nM. | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 4.5 ± 2.2 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |