Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 19
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0059 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 19 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGCTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | Survival rate of mice with LPS-induced sepsis increased from 10% to 75% after treatment. | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0060 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 18 | TAGGGAATTCGTCACGGATCC-GGCGTCCACTCCCAGCCGGTCACTAGTTTCTGCGTGGGTGA-CTGCAGGTCGACGCATGCGCCG | 84 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0061 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 31 | TAGGGAATTCGTCACGGATCC-GGAGAATAACGACAAAAGGTAAACTACAGGCCCGGAGC-CTGCAGGTCGACGCATGCGCCG | 81 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0062 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 14 | TAGGGAATTCGTCACGGATCC-AAAAGTCCTTGCAAGATAGACGCAGCCAGCCGGGTAGTC-CTGCAGGTCGACGCATGCGCCG | 82 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0063 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 25 | TAGGGAATTCGTCACGGATCC-CTTGGCGTTACTTACCTGTACGTCGTAGAG-CTGCAGGTCGACGCATGCGCCG | 73 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0064 | 19265672 | 2009 | A novel lipopolysaccharide-antagonizing aptamer protects mice against endotoxemia | Aptamer 43 | TAGGGAATTCGTCACGGATCC-TGAACGACGTCGCATTAGCGAGTAGGTTTACGAAGTAAGA-CTGCAGGTCGACGCATGCGCCG | 83 | 5'-TAGGGAATTCGTCACGGATCC-N40-CTGCAGGTCGACGCATGCGCCG-3' | ssDNA | Gram-negative Bacteria | Endotoxin (Lipopolysaccharide (LPS)) | Identify aptamers that bind to and inhibit LPS-induced sepsis by decreasing NF-κB activation of monocytes. | N/A | 12 | Nitrocellulose Filter Binding Assay | N/A | Diagnostic/Therapeutics | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1038 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A011 | CCAAGCUUGCAUGCCUGCAG-GGACUGUGGAUUGUUCUGGGUGCCGCUUCUCCGAAUAUCGGACUCUCGAACUCCUGGGGA-GGUACCGAGCUCGAAUUCCC | 100 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | 267 ± 48 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1039 | 30563044 | 2018 | 2'-Fluoro-Pyrimidine-Modified RNA Aptamers Specific for Lipopolysaccharide Binding Protein (LBP) | A036 | CCAAGCUUGCAUGCCUGCAG-GAUAUACGGUGCCGCUUCUCUAACCGGUGGUCAUGCGGUUGGACGCUCGAACAGACUA-GGUACCGAGCUCGAAUUCCC | 98 | 5'-CCAAGCTTGCATGCCTGCAG-N60-GGTACCGAGCTCGAATTCCC-3' | ssRNA | Gram-negative Bacteria | Murine Lipopolysaccharide Binding Protein (mLBP) | Identify aptamers that bind to and inhibit the LPS-LBP interaction or block of LBP-mediated transfer of LPS monomers to CD14. | N/A | 8 | Nitrocellulose Filter Binding Assay | N/A | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1203 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G1 | CAGGTCCATCGAGTGGTA-GGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAG-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 3.1 ± 1.2 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1204 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G3 | CAGGTCCATCGAGTGGTA-TGCAGCGGACAGTGTGGGACCATCGCTGCGGATGTATGAA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 5.6 ± 2.4 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1205 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G7 | CAGGTCCATCGAGTGGTA-CCCAACCCACGATGCGCAAGAGGAATGCAGCCTACCAGCA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 4.6 ± 1.6 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1206 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G1-T1 | TAGGAGGAGGTATTTAGTGCCAAGCCATCTCAAACGACGTCTGAGTCGCACTGCTCCTG | 59 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | Achieved a detection limit of 1 nM. | 10 | Electrophoretic Mobility Shift Assay (EMSA) | 4.5 ± 2.2 nM | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1207 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G2 | CAGGTCCATCGAGTGGTA-CCGAGTTCCCAATATTATGGCTATGCAGGATACTTCACCT-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1208 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G4 | CAGGTCCATCGAGTGGTA-TGAGTACTAGTTCCCCAGGAGAAAGCAGATCCCCAGGTAC-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1209 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G5 | CAGGTCCATCGAGTGGTA-GCACAGGACGCAAGATGAATGCAGCATACCAGTCCCTAGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1210 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G6 | CAGGTCCATCGAGTGGTA-CAGCTGTCGACGCGTTACCGTGAACGGAACACCGATGACG-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1211 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G8 | CAGGTCCATCGAGTGGTA-TGCGTGATTGGACCAGGGAAAGATGCACCGCAAGACAAGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1212 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G9 | CAGGTCCATCGAGTGGTA-AGGATAATCCGATACGCAAGAAGAAAGCAGATTACCAGGA-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1213 | 28882627 | 2018 | Selection and characterization of DNA aptamers for detection of glutamate dehydrogenase from Clostridium difficile | anti-G10 | CAGGTCCATCGAGTGGTA-CAAAGTCGGCAAGGTGGAAAGCAGCCACACCACGACTAGT-TCGCACTGCTCCTGAACGTAC | 79 | 5'-CAGGTCCATCGAGTGGTAGGA-N40-TCGCACTGCTCCTGAACGTAC-3' | ssDNA | Clostridium Difficile | Glutamate dehydrogenase (GDH) | Identify anti-GDH DNA aptamers and develop a structuring-switching aptamer sensor for its detection. | N/A | 10 | Electrophoretic Mobility Shift Assay (EMSA) | N/A | Detection | SELEX | 5'-Radiolabelled ([γ-32P]-ATP-labeled) | N/A | N/A | N/A | N/A | N/A |