Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1849 | https://doi.org/10.1016/j.biosx.2023.100436 | 2024 | DNA origami-enhanced binding of aptamers to Staphylococcus aureus cells | PA#2/8 [1–58] | ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT | 58 | N/A | ssDNA | Staphylococcus aureus (S. aureus) SA5 | Staphylococcus aureus Protein A (SpA) | Developed a DNA origami-based biosensor for the detection of SA. | Five-times higher affinity of the aptamer-functionalized DNA origami compared to pure aptamers. | N/A | Enzyme-Linked Oligonucleotide Assay (ELONA) | 160 ± 9 nM | Biosensor | N/A | 5'-PolyA (21A) or PolyT (21 T) | N/A | N/A | N/A | N/A | N/A |