Modification : 5'-PolyA (21A) or PolyT (21 T)

Total records found: 1

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1849 https://doi.org/10.1016/j.biosx.2023.1004362024DNA origami-enhanced binding of aptamers to Staphylococcus aureus cellsPA#2/8 [1–58]ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT58N/AssDNAStaphylococcus aureus (S. aureus) SA5Staphylococcus aureus Protein A (SpA)Developed a DNA origami-based biosensor for the detection of SA.Five-times higher affinity of the aptamer-functionalized DNA origami compared to pure aptamers.N/AEnzyme-Linked Oligonucleotide Assay (ELONA)160 ± 9 nMBiosensorN/A5'-PolyA (21A) or PolyT (21 T)N/AN/AN/AN/AN/A