Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 4
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1330 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-E1 | AAAAAAAAAA-TTTTT-ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT | 52 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | The detection limit of the current SPR aptasensor is 1 x 10(5) CFU/mL for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1331 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-E2 | AAAAAAAAAA-TTTTT-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 57 | N/A | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1332 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S1 | AAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 77 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | The detection limit of the current SPR aptasensors is 1 x 10(6) CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1333 | 31080198 | 2019 | Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens | 10A-S2 | AAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 103 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus. | N/A | N/A | N/A | N/A | Biosensor | N/A | 5'-PolyA (10A) and Five thymine (5T) | N/A | N/A | N/A | N/A | N/A |