AptBacterialDB

Modification : 5'-PolyA (10A) and Five thymine (5T)

Total records found: 4

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1330 310801982019Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens10A-E1AAAAAAAAAA-TTTTT-ATCAAATGTGCAGATATCAAGACGATTTGTACAAGAT52N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus.The detection limit of the current SPR aptasensor is 1 x 10(5) CFU/mL for E. coli.N/AN/AN/ABiosensorN/A5'-PolyA (10A) and Five thymine (5T)N/AN/ABest CandidateN/AN/A
ABdb_1331 310801982019Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens10A-E2AAAAAAAAAA-TTTTT-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG57N/AssDNAEscherichia Coli (E. Coli)Whole cellDeveloped a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus.N/AN/AN/AN/ABiosensorN/A5'-PolyA (10A) and Five thymine (5T)N/AN/AN/AN/AN/A
ABdb_1332 310801982019Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens10A-S1AAAAAAAAAA-TTTTT-TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC77N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus.The detection limit of the current SPR aptasensors is 1 x 10(6) CFU/mL for S. aureus.N/AN/AN/ABiosensorN/A5'-PolyA (10A) and Five thymine (5T)N/AN/ABest CandidateN/AN/A
ABdb_1333 310801982019Polyadenine-mediated Immobilization of Aptamers on a Gold Substrate for the Direct Detection of Bacterial Pathogens10A-S2AAAAAAAAAA-TTTTT-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA103N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a SPR-based aptasenor using polyadenine-mediated immobilization of aptamers on a gold substrate for the detection of E. coli or S. aureus.N/AN/AN/AN/ABiosensorN/A5'-PolyA (10A) and Five thymine (5T)N/AN/AN/AN/AN/A