Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 2
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1468 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | Ab-Apt | TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT | 43 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1469 | 32095939 | 2020 | A fluorometric assay for rapid enrichment and determination of bacteria by using zirconium-metal organic frameworks as both capture surface and signal amplification tag | LPS-Apt | CTTCTGCCCGCCTCCTTCCTAGCCGGATCGCGCTGGCCAGATGATATAAAGGGTCAGCCCCCCAGGAGACGAGATAGGCGGACACT | 86 | N/A | ssDNA | Acinetobacter Baumannii | Lipopolysaccharide (LPS) | A fluorometric assay was developed to determine A. baumannii in blood samples by utilizing Zr-MOFs as capture probe (denoted as Zr-mMOF-p-Ab-Apt) and signal probe (denoted as F@UIO-66-NH2-p-LPS-Apt). | The limit of detection of A. baumannii in blood samples is 10 cfu/mL with a linear range of 10(1)–10(5) cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |