Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1566 | 34731314 | 2021 | An electrochemical aptasensor for Mycobacterium tuberculosis ESAT-6 antigen detection using bimetallic organic framework | EBA | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | A label-free electrochemical aptasensor was developed using NG@Zr-MOF-on-Ce-MOF@Tb nanohybrid for sensitive detection of ESAT-6. | Displayed a wide linear range from 100 fg/mL to 10 ng/mL with a limit of detection (LOD) of 12 fg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (PO4(-3)) | N/A | The current remained at 95.77% and 88.72% of the initial current after storing at at 4℃ for 8 days and 16 days, respectively. | N/A | N/A | N/A |