Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1256 | 30608683 | 2019 | Visualized Detection of Vibrio parahaemolyticus in Food Samples Using Dual-Functional Aptamers and Cut-Assisted Rolling Circle Amplification | D-Apt | CCTCAGCATAAGCATGAATTGACCAACCTAAACTTATTCATTTTCCAGCACCTCTAATATTACTGGCGCAGTGCACCCACCCACCCACCC | 90 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | A biosensor using Dual-Apt and cut-assisted rolling circle amplification (CA-RCA) for rapid and visualized detection of Vibrio parahaemolyticus. | Shows a good linear correlation in the range from 10(6) to 10 CFU/mL and LOD as low as 10 CFU/mL (g) in real food samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Phosphate (3'-end phosphorylation) | N/A | N/A | N/A | N/A | N/A |