Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1262 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4 | CAACGAAACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 28.65 ± 3.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Biotinylated (Biotin-TTTTTTTTT) | N/A | N/A | Best Candidate | N/A | N/A |