Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1815 | https://doi.org/10.1016/j.cej.2023.143099 | 2023 | Design nanoprobe based on DNA tetrahedron supported hybridization chain reaction and its application to in situ analysis of bacteria | Aptamer (AA) | AGTGCGCAGCTAGCAAGGCCTTTTTTTTTTGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 118 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 6538) | Whole cell | Developed a nanoprobe (DTAAT) based on DNA tetrahedral supported hybridization chain reaction (HCR) for in situ analysis of SA. | Detect SA with the detection limit as low as 26 CFU/mL and linear range of 50-5×10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-FAM Labeled and 3'-Thiolated | N/A | N/A | N/A | N/A | N/A |