Modification : 5'-FAM Labeled and 3'-Amidation (NH₂)

Total records found: 3

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0427	24280049	2014	Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria	E1	GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA	88	N/A	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Surface protein	Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.	In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).	N/A	N/A	12.4 nM	Biosensor	N/A	5'-FAM Labeled and 3'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A
ABdb_0428	24280049	2014	Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria	E2	GCAATGGTACGGTACTTCCCCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCGCAAAAGTGCACGCTACTTTGCTAA	88	N/A	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Surface protein	Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.	In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).	N/A	N/A	25.2 nM	Biosensor	N/A	5'-FAM Labeled and 3'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A
ABdb_0429	24280049	2014	Aptamer cocktails: enhancement of sensing signals compared to single use of aptamers for detection of bacteria	E10	GCAATGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA	90	N/A	ssDNA	Escherichia Coli (E. Coli) (KCTC 2571)	Surface protein	Developed an aptamer cocktail with different components on the cell surface to enhance the sensing signal for bacterial detection.	In electrochemical detection, the cocktail achieved an approximately 3.7 × 10^2 CFU/mL LOD (18-fold lower than the average single aptamer).	N/A	N/A	14.2 nM	Biosensor	N/A	5'-FAM Labeled and 3'-Amidation (NH₂)	N/A	N/A	N/A	N/A	N/A