AptBacterialDB

Modification : 5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL)

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0463 250963912014Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidisSe1CACACCGGAAGGGATGCCACCTAAACCCC295'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNASalmonella Enteritidis (S. Enteritidis)Whole cellIdentify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium.The binding efficiency of the PDAP of Se1 was approximately 100-fold higher than that of the single aptamer.10Fluorescence Spectroscopy4.66 ± 0.35 μM (of single aptamer) and 57.86 ± 14.5 nM (of PDAP)DetectionWhole Cell-SELEX5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL)N/AN/AN/AN/AN/A
ABdb_0464 250963912014Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidisSe2CACAGATGACGTCTGGCACATAATTAACAC305'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNASalmonella Enteritidis (S. Enteritidis)Whole cellIdentify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium.The binding efficiency of the PDAP for Se2 was approximately 80-fold higher than that of the single aptamer.10Fluorescence Spectroscopy3.83 ± 0.10 μM (of single aptamer) and 55.84 ± 24.7 nM (of PDAP)DetectionWhole Cell-SELEX5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL)N/AN/AN/AN/AN/A
ABdb_0465 250963912014Development of ssDNA aptamers for the sensitive detection of Salmonella typhimurium and Salmonella enteritidisSt1CCGATGTCCGTTAGGGCTCCTCCATAGAT295'-GCGCGGATCCCGCGC-N30-CGCGCGAAGCTTGCG-3'ssDNASalmonella Typhimurium (S. Typhimurium)Whole cellIdentify aptamers that can be used as detection probes in a polyvalent directed aptamer polymer (PDAP), which specifically bind to S. enteritidis and S. typhimurium.The binding efficiency of the PDAPs of St1 was approximately 20-fold higher than that of the single aptamer.10Fluorescence Spectroscopy0.530 ± 0.01 μM (of single aptamer) and 25 ± 5.6 nM (of PDAP)DetectionWhole Cell-SELEX5'-FAM Labeled, 3'-Thiolated and Poly-D-Lysine (PDL)N/AN/AN/AN/AN/A