Modification : 5'-Dodeca-G (G12)

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1847	38040292	2024	One-pot rapid visual detection of E. coli O157:H7 by label-free AuNP-based plasmonic-aptasensor in water sample	(PGM) aptamer	CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG	42	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7 (ATCC 43895)	Whole cell	A label-free biosensor was developed using an aptamer and single-pot Au nanoparticle (AuNP) for the detection of E. coli O157:H7.	Could identify target bacteria with as few as 250 CFU/ml in 15 min or less.	N/A	N/A	N/A	Biosensor	N/A	5'-Dodeca-G (G12)	N/A	After five days (stored at 4°C) from synthesizing PG-apt-AuNPs, its performance in detecting 10(5) CFU/ml of E. coli O157:H7 is similar to that of newly synthesized biosensor.	N/A	N/A	N/A