Modification : 5'-DIG (Digoxigenin) Labeled

Total records found: 9

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0083	https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456	2010	In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX	Sequence A	GCCCAATCGCCGTCTTCTACA-TGTGCGTGTGTCAGCGAATATCACCTAGAGGTCGG-AGTGCCAACGCCCTCCTGAT	76	5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3'	ssDNA	Vibrio Alginolyticus	Whole cell	Identify a high-affinity aptamer against Vibrio alginolyticus.	Bind to different sites of the V. alginolyticus surface.	15	N/A	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0084	https://doi.org/10.4028/www.scientific.net/KEM.439-440.1456	2010	In Vitro Selection of Oligonucleotide Acid Aptamers against Pathogenic Vibrio Alginolyticus by SELEX	Sequence B	CCCAATCGCCGTCTTCTACA-TGTATGCTGCCGAGGTTGGCCTCTTAGTCAGCTGAGAGTGCCAACGCCCTCCTGATATGCCCAATCGCCGTCTTCTACATTGTGGTCGTGGGAATGCATTCATCCGTTGCCGG-AGTGCCAACGCCCTCC	149	5'-GCCCAATCGCCGTCTTCTACA-N35-AGTGCCAACGCCCTCCTGAT-3'	ssDNA	Vibrio Alginolyticus	Whole cell	Identify a high-affinity aptamer against Vibrio alginolyticus.	Bind to different sites of the V. alginolyticus surface.	15	N/A	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0709	https://doi.org/10.1016/j.lwt.2015.07.021	2015	Identification and characteristics of aptamers against inactivated Vibrio alginolyticus	Aptamer #7	TCAGTCGCTTCGCCGTCTCCTTC-GGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG-GCACAAGAGGGAGACCCCAGAGGG	79	N/A	ssDNA	Vibrio Alginolyticus	Whole cell	Develop an aptamer detection assay for inactivated V. alginolyticus.	The detection limit for aptamer #7 for inactivated V. alginolyticus was 10 cells/ml.	N/A	Fluorescence Spectroscopy	28.39 ± 11.46 nM	Detection	N/A	5'-DIG (Digoxigenin) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0710	https://doi.org/10.1016/j.lwt.2015.07.021	2015	Identification and characteristics of aptamers against inactivated Vibrio alginolyticus	Aptamer #8	TCAGTCGCTTCGCCGTCTCCTTC-AGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG	82	N/A	ssDNA	Vibrio Alginolyticus	Whole cell	Develop an aptamer detection assay for inactivated V. alginolyticus.	The detection limit for aptamer #8 for inactivated V. alginolyticus was 10 cells/ml.	N/A	Fluorescence Spectroscopy	12.82 ± 6.00 nM	Detection	N/A	5'-DIG (Digoxigenin) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0711	https://doi.org/10.1016/j.lwt.2015.07.021	2015	Identification and characteristics of aptamers against inactivated Vibrio alginolyticus	Aptamer #23	TCAGTCGCTTCGCCGTCTCCTTC-GTAGGAGGTAGTCGGAGAGGCGAATGAGAGGGGAAGCACAAGAGGGA-GCACAAGAGGGAGACCCCAGAGGG	94	N/A	ssDNA	Vibrio Alginolyticus	Whole cell	Develop an aptamer detection assay for inactivated V. alginolyticus.	The detection limit for aptamer #23 for inactivated V. alginolyticus was 10(3) cells/ml.	N/A	Fluorescence Spectroscopy	46.89 ± 15.87 nM	Detection	N/A	5'-DIG (Digoxigenin) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_2113	https://doi.org/10.1016/j.snb.2017.02.098	2017	Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators	PA05	N/A	N/A	N/A	ssDNA	Streptococcus Pneumoniae	Surface-specific Protein PavA	Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.	N/A	8	Enzyme-Linked Oligonucleotide Assay (ELONA)	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))	N/A	N/A	N/A	N/A	N/A
ABdb_2114	https://doi.org/10.1016/j.snb.2017.02.098	2017	Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators	PA08	N/A	N/A	N/A	ssDNA	Streptococcus Pneumoniae	Surface-specific Protein PavA	Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.	The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor.	8	Enzyme-Linked Oligonucleotide Assay (ELONA)	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))	N/A	N/A	Best Candidate	N/A	N/A
ABdb_2115	https://doi.org/10.1016/j.snb.2017.02.098	2017	Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators	FH05	N/A	N/A	N/A	ssDNA	Neisseria Meningitidis	Surface-specific Protein FHbp	Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.	The polyclonal population PA08 showed a frequency shift four times greater and a faster reaction rate than FH05 when measured on the gravimetric sensor.	8	Enzyme-Linked Oligonucleotide Assay (ELONA)	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))	N/A	N/A	Best Candidate	N/A	N/A
ABdb_2116	https://doi.org/10.1016/j.snb.2017.02.098	2017	Selection of aptamers to Neisseria meningitidis and Streptococcus pneumoniae surface specific proteins and affinity assay using thin film AlN resonators	FH08	N/A	N/A	N/A	ssDNA	Neisseria Meningitidis	Surface-specific Protein FHbp	Generated SOMAmers against surface-specific proteins PavA and FHbp and developed a gravimetric aptasensor for the detection of S. pneumoniae and N. meningitidis.	N/A	8	Enzyme-Linked Oligonucleotide Assay (ELONA)	N/A	Detection	SELEX	5'-DIG (Digoxigenin) Labeled and 5-tryptaminocarbonyl-dU (TrpdU))	N/A	N/A	N/A	N/A	N/A