Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 42
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0358 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-27 | ACGGCTCGCACTCTCTGATTT-GGCATAGCTGCCGGGAGGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | The binding signal of EcA5-27 for E. coli NSM59 was notably higher (~ 1.5-fold) than for laboratory strains of E. coli, and 8.5- and 56-fold to additional uropathogenic isolates compared with laboratory strains. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 110 nM | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0359 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-01 | ACGGCTCGCACTCTCTGATTT-CGGCACCCCGTCGCTATGTTGACC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0360 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-02 | ACGGCTCGCACTCTCTGATTT-GGGGAGGTGGCGACCGCTTCTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0361 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-03 | ACGGCTCGCACTCTCTGATTT-GGGGTCAGATATTAAACCGTGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0362 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-04 | ACGGCTCGCACTCTCTGATTT-GGGAGAGGGAGTGGTCTGGGAGAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0363 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-05 | ACGGCTCGCACTCTCTGATTT-GCGGGCTTCGACACAGTGGGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0364 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-06 | ACGGCTCGCACTCTCTGATTT-GGGAGGGGCGGCGAAGGAGTGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0365 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-07 | ACGGCTCGCACTCTCTGATTT-GGAAGCGGTGGGGATCGTGTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0366 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-08 | ACGGCTCGCACTCTCTGATTT-GGGAGCAAATCCGGAATGTGGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0367 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-09 | ACGGCTCGCACTCTCTGATTT-GGCGGAGGGGTTCGGGGTTGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0368 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-10 | ACGGCTCGCACTCTCTGATTT-GGCGGGGCGTGGGGGATGTGTGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0369 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-11 | ACGGCTCGCACTCTCTGATTT-GGAATGCGAAGTGTGGCCTAGGGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0370 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-12 | ACGGCTCGCACTCTCTGATTT-GGGCGGGGGGGGATTCCGAGGCGC-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0371 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-13 | ACGGCTCGCACTCTCTGATTT-GGGGGGGTGGCATTTTGGGGTGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0372 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-14 | ACGGCTCGCACTCTCTGATTT-GCGGGGAAAGAGAAGGAAGCGTCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0373 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-15 | ACGGCTCGCACTCTCTGATTT-GGGCCCGAGTGGCGGTAGTTTCAG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0374 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-16 | ACGGCTCGCACTCTCTGATTT-GGGGGGTGGTGAAGGCCTGGGGGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0375 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-17 | ACGGCTCGCACTCTCTGATTT-GGGCCGGAGGGGCGCCTGCACCCA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0376 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-18 | ACGGCTCGCACTCTCTGATTT-GGGGTTAGGCGAGGGGGGTGGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0377 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-19 | ACGGCTCGCACTCTCTGATTT-CGGACGGTAGGGAAGGGGGGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0378 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-20 | ACGGCTCGCACTCTCTGATTT-GGCGAGGCAGGGTGCGGGGGCCCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0379 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-21 | ACGGCTCGCACTCTCTGATTT-GCGTGTGGTGGGTGAGGGGTCTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0380 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-22 | ACGGCTCGCACTCTCTGATTT-GGGGATAGCAGGACAATGAGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0381 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-23 | ACGGCTCGCACTCTCTGATTT-GGCCGCGTGTGTGTCCGACTGGTG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0382 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-24 | ACGGCTCGCACTCTCTGATTT-GGGCGAGGAGAGAGGCGGAGGGCG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0383 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-25 | ACGGCTCGCACTCTCTGATTT-GCCGTGGTGTGTGTGATGGTCGGT-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0384 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-26 | ACGGCTCGCACTCTCTGATTT-GGCTTGGCTCCTCACGGGGGGTGA-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0385 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-28 | ACGGCTCGCACTCTCTGATTT-GGAGGGGTTGACCATGACCGGGGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0386 | 25008464 | 2014 | Selection of DNA aptamers against uropathogenic Escherichia coli NSM59 by quantitative PCR controlled Cell-SELEX | EcA5-29 | ACGGCTCGCACTCTCTGATTT-GGGGGAAGGGCCAATGGATTGTGG-TTTACTCCTGCGTGCTTCTCA | 66 | 5'-ACGGCTCGCACTCTCTGATTT-N24-TTTACTCCTGCGTGCTTCTCA-3' | ssDNA | Escherichia Coli (E. Coli) NSM59 Uropathogenic strain | Whole cell | Identify aptamers that bind specifically to E. coli NSM59 cells. | N/A | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | N/A | Detection | Whole Cell-SELEX | 5'-FITC and 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0897 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-3 | ATACCAGCTTATTCAATTCCA-TGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 39.32 ± 5.02 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0964 | 28987879 | 2017 | Thioaptamer targeted discoidal microparticles increase self immunity and reduce Mycobacterium tuberculosis burden in mice | CD44 Thioaptamer (CD44TA) | GAGATTCATCACGCGCATAGTCTTGGGA*CGGTGTTA*A*A*CGA*A*A*GGGGA*CGA*CCCGA*CTA*TGCGA*TGA*TGTCTTC | 74 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | CD44 receptor (Mtb-infected murine macrophages) | Develop a targeting system using CD44 thioaptamers (TA)-conjugated discoidal silicon mesoporous microparticles (SMP) to enhance accumulation of these agents/carriers in the infected macrophages in the lungs. | CD44TA-SMP treatment increased IP-10 (CXCL-10), MCP-1, MCP-2, and RANTES, with no change in IL-6 release compared to the control. | N/A | N/A | N/A | Therapeutics | N/A | *= 5'-monothio-dA and 5'-Cyanine5 (Cy5) Labeled | In uninfected murine and human macrophages, SMP and CD44TA-SMP did not affect the cell viability. | N/A | N/A | N/A | N/A |
| ABdb_1149 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S24 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGACGGCTATCTCATTTGGCACATCATTTAGTAAGCTATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 3.75 ×10(-3) M | Detection | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled or 5′-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1455 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C1R1 | TAGGGAAGAGAAGGACATATGAT-GCGCGCGAGATTAACCCCCCAATGCTGCACCGAGCCACGA-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | With 250 cells as the lowest measured cell number by the C1R1. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | 31 ± 2 nM | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1456 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R1 | TAGGGAAGAGAAGGACATATGAT-GCGGCAGGGAAGGACTATGTGGGTGAAAGGAGTGCGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1457 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C2R2 | TAGGGAAGAGAAGGACATATGAT-GCAGCGGGATGGGGTAAATGGTGGCGAGAGGCGTCGGGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1458 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C4R2 | TAGGGAAGAGAAGGACATATGAT-GCGGGTTGACTAGTACATGACCACTTGAGTCGCTTGAACT-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | Labelling efficiency by C4R2 of approximately 60 % fluorescence signal relative to R16 values. The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1459 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C6R3 | TAGGGAAGAGAAGGACATATGAT-GCGGGGAGAGGCGAAAGAAGCTGGGATGGAAGGGCGTAGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1460 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R5 | TAGGGAAGAGAAGGACATATGAT-GCAGCCACAGCAGAGACGGGAAGGGCCAGGGTTGAGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1461 | 32515842 | 2020 | The Diversity of a Polyclonal FluCell‐SELEX Library Outperforms Individual Aptamers as Emerging Diagnostic Tools for the Identification of Carbapenem Resistant Pseudomonas aeruginosa | C10R6 | TAGGGAAGAGAAGGACATATGAT-GCGGCGGTGGGGCTTTCGGTGATTTGGGCGGTTTGGCGGG-TCAAGTGGTCATGTACTAGTCAA | 86 | 5'-TAGGGAAGAGAAGGACATATGAT-40N-TCAAGTGGTCATGTACTAGTCAA-3' | ssDNA | Pseudomonas Aeruginosa PAO1 | Outer membrane protein (OMP) OprF, OprM and OprD | Identify an aptamer library that specifically targets different clinically relevant strains, thereby inhibiting virulence-associated cellular functions. | The R16 aptamer library outperformed single aptamers in labelling and inhibiting biofilm and motility. | 16 | Fluorescence Spectroscopy | N/A | Therapeutics | FluCell‐SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1725 | 34847360 | 2022 | A new cognate aptamer pair-based sandwich-type electrochemical biosensor for sensitive detection of Staphylococcus aureus | SA37 (SA-10R-37) | GCTTCCAGCTTATTGAAT-AAAGACGGGGGGGGGGACCGGCGTATGAGTGAAGATGGGG-GCGCTGAAGCGCGGAAGC | 76 | 5'-GCTTCCAGCTTATTGAAT-40N-GCGCTGAAGCGCGGAAGC-3' | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | A sandwich-type signal-on electrochemical aptasensor using a cognate aptamer pair was developed for the detection of S. aureus. | Achieved a limit of detection (LOD) of 39 CFUs and 414 CFUs in buffer and spiked tap water samples, respectively, with the cognate pair of SA37@Cy5 and SA81@FAM. | 10 | Flow Cytometry | 16.5 ± 3.41 nM | Biosensor | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1788 | 37196408 | 2023 | A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniae | AB | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples. | Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB. | N/A | N/A | 6.8 nM | Biosensor | N/A | 5'-Cyanine5 (Cy5) Labeled and 5'-Amidation (NH₂-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1883 | 41431270 | 2025 | Bioimaging with fluorescent nucleic-acid aptamers for the specific detection and quantification of Pseudomonas aeruginosa alone and in heterogeneous bacterial populations | F23 | ATACCAGCTTATTCAATT-CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG-AGATAGTAAGTGCAATCT | 96 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 15692) | Whole cell | Develop a fluorescent aptamer for detecting Pseudomonas aeruginosa. | 73.79% of live P. aeruginosa cells (3102/4204) were labeled by the Cy5‐F23 aptamer, compared to only 0.06% of live S. aureus (4/6767). | 15 | Flow Cytometry | 17.27 ± 5.00 nM | Imaging | Whole Cell-SELEX | 5'-Cyanine5 (Cy5) Labeled | N/A | The aptamer remains highly stable for 72 hours. | N/A | N/A | N/A |