Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 4
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1778 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T1-280 | ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T1-280 RNA was 113 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 2.2 ± 0.5 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1779 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T2-139040 | ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T2-139040 RNA was 17 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 1.0 ± 0.3 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1780 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T3-117558 | ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T3-117558 RNA was 11 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 0.7 ± 0.4 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1781 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | A14 | ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 54 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of A14 DNA was 485 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 4 ± 2 nM | Detection | N/A | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC) | N/A | N/A | N/A | N/A | N/A |