Modification : 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC)

Total records found: 4

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1778	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	T1-280	ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU	46	N/A	ssRNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of T1-280 RNA was 113 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	2.2 ± 0.5 nM	Detection	In-silico Method	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide	N/A	N/A	N/A	N/A	N/A
ABdb_1779	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	T2-139040	ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU	46	N/A	ssRNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of T2-139040 RNA was 17 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	1.0 ± 0.3 nM	Detection	In-silico Method	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide	N/A	N/A	N/A	N/A	N/A
ABdb_1780	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	T3-117558	ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC	46	N/A	ssRNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of T3-117558 RNA was 11 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	0.7 ± 0.4 nM	Detection	In-silico Method	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide	N/A	N/A	N/A	N/A	N/A
ABdb_1781	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	A14	ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT	54	N/A	ssDNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of A14 DNA was 485 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	4 ± 2 nM	Detection	N/A	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC)	N/A	N/A	N/A	N/A	N/A