Modification : 5'-Cyanine3 (Cy3) Labeled

Total records found: 11

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0338	23929394	2013	A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection	L. acidophilus (FALA)	ATCCGTCACACCTGCTCTACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTATGGTGTTGGCTCCCGTAT	73	N/A	ssDNA	Lactobacillum Acidophilius (ATCC 4356)	Whole cell	Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection.	Detection limits (LOD) of 11.0 cfu/mL (L. acidophilus).	N/A	N/A	13 nM	Biosensor	N/A	5'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0339	23929394	2013	A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection	S. aureus (FASA)	GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA	88	N/A	ssDNA	Staphylococcus aureus (S. aureus) (ATCC 29213)	Whole cell	Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection.	Detection limits (LOD) of 800.0 cfu/mL (S. aureus) and linear ranges of 10(4)–10(6) cfu/mL.	N/A	N/A	35 nM	Biosensor	N/A	5'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0340	23929394	2013	A PDMS/paper/glass hybrid microfluidic biochip integrated with aptamer-functionalized graphene oxide nano-biosensors for one-step multiplexed pathogen detection	S. enterica (FASE)	TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG	40	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium) (ATCC 14028)	Whole cell	Developed an aptamer-functionalized graphene oxide (GO) nano-biosensor for multiplexed pathogen detection.	Detection limits (LOD) of 61.0 cfu/mL (S. enterica) and linear ranges of 42.2–675.0 cfu/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_0821	https://doi.org/10.1016/j.foodcont.2015.11.031	2016	Vibrio parahaemolyticus detection aptasensor using surface-enhanced Raman scattering	Aptamer	TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT	40	N/A	ssDNA	Vibrio Parahaemolyticus (ATCC 17802)	Whole cell	A SERS-based aptasensor was developed using Au@Ag core-shell nanoparticles for the detection of V. parahaemolyticus.	Achieved a concentration in the linear range of 10–10(6) cfu/mL, with a limit of detection of 10 cfu/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Thiolated (for apt 1) and 5'-Cyanine3 (Cy3) Labeled (for apt 2)	N/A	N/A	N/A	N/A	N/A
ABdb_1001	https://doi.org/10.1016/j.snb.2017.05.146	2017	A simple dendrimer-aptamer based microfluidic platform for E. coli O157:H7 detection and signal intensification by rolling circle amplification	Aptamer	ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT	72	N/A	ssDNA	Escherichia Coli (E. Coli) O157:H7	Whole cell	Developed a dendrimer-aptamer microfluidic detection system with Rolling circle amplification (RCA) for the detection of E. coli O157:H7 cells.	RCA was able to enhance detection signals by up to 50 times, and the limit of detection of the system was reduced to 10(2) cells/mL.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂) and 5'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1181	32254837	2018	Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags	E1	GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA	88	N/A	ssDNA	Escherichia Coli (E. Coli)	Whole cell	Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus.	The LOD of the platform was 50 cells/mL for E. coli, and capture efficiency reached 74.96% within 15 min.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂-(CH2)6) and 5'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1226	31403764	2019	Rapid Detection of Mycoplasma-Infected Cells by an ssDNA Aptamer Probe	Aptamer A15-1	GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA	40	5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3'	ssDNA	Mycoplasma-Infected Cells (Jeko-1 lymphoma cells)	Whole cell	Develop an aptamer probe for the rapid detection of mycoplasma-infected cells.	Mycoplasma-positive cells showed a strong signal, but no signal was detected in the mycoplasma-negative cells.	15	Flow Cytometry	24.5 nM	Detection	Whole Cell-SELEX	5'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1778	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	T1-280	ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU	46	N/A	ssRNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of T1-280 RNA was 113 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	2.2 ± 0.5 nM	Detection	In-silico Method	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide	N/A	N/A	N/A	N/A	N/A
ABdb_1779	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	T2-139040	ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU	46	N/A	ssRNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of T2-139040 RNA was 17 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	1.0 ± 0.3 nM	Detection	In-silico Method	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide	N/A	N/A	N/A	N/A	N/A
ABdb_1780	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	T3-117558	ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC	46	N/A	ssRNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of T3-117558 RNA was 11 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	0.7 ± 0.4 nM	Detection	In-silico Method	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide	N/A	N/A	N/A	N/A	N/A
ABdb_1781	37327207	2023	FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers	A14	ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT	54	N/A	ssDNA	Staphylococcus aureus (S. aureus)	Iron-regulated Surface Determinant Protein A (IsdA)	Develop a FRET-based aptasensor for single-molecule detection of IsdA.	LOD value of A14 DNA was 485 pM.	N/A	Fluorescence Resonance Energy Transfer Assay (FRET)	4 ± 2 nM	Detection	N/A	5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC)	N/A	N/A	N/A	N/A	N/A