Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 1
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_1344 | 31033156 | 2019 | Inkjet Printed Nanopatterned Aptamer-Based Sensors for Improved Optical Detection of Foodborne Pathogens | a-aptamer | ATCAAATGTGCAGATATCAAGACGATTTGTACAAGATCCATGCTGAGGTGGTCATAGCTGATCCTACC | 68 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed an inkjet-printed nanopatterned aptamer-based sensor for optical detection of E. coli O157:H7. | Display a LOD of 25 CFU/mL in pure culture and 233 CFU/mL in ground beef. | N/A | Bio-Layer Interferometry (BLI) | N/A | Biosensor | N/A | 5'-Carboxy and 5'-Biotin-TEG | N/A | N/A | N/A | N/A | N/A |