AptBacterialDB

Modification : 5'-COOH (Carboxylated)

Total records found: 7

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_1200 295338182018Culture-free, highly sensitive, quantitative detection of bacteria from minimally processed samples using fluorescence imaging by smartphoneS. aureus–specific aptamer (Sap)TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC62N/AssDNAStaphylococcus aureus (S. aureus) (USA300)Surface proteinDeveloped a smartphone-based detection using aptamer-functionalized fluorescent magnetic nanoparticles (FMNPs) for Staphylococcus aureus.Showed a minimum detectable concentration as low as 10 cfu/ml in a peanut milk sample within 10 min.N/AN/A3.03 nMBiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A
ABdb_1234 313621882019Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samplesP. aeruginosa aptamer1CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas Aeruginosa (ATCC 15442)Whole cellA dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa.The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h.N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A
ABdb_1235 313621882019Dual-aptamers labeled polydopamine-polyethyleneimine copolymer dots assisted engineering a fluorescence biosensor for sensitive detection of Pseudomonas aeruginosa in food samplesP. aeruginosa aptamer2ATGCACTCTTCTATCGGTAGTTGAGGGTGCGG32N/AssDNAPseudomonas Aeruginosa (ATCC 15442)Whole cellA dual aptamer labelled PDA-PEI copolymer dots-based biosensor for detection and quantification of P. aeruginosa.The LOD of P. aeruginosa is as low as 1 cfu/mL with a linear range from 10(1)–10(7) cfu/mL in 1.5h.N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A
ABdb_1770 381570412023A point-of-care aptasensor based on the upconversion nanoparticles/MoS2 FRET system for the detection of Pseudomonas aeruginosa infectionAptamerCCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG60N/AssDNAPseudomonas AeruginosaWhole cellDevelop an aptasensor based on FRET between UCNPs-apt/MoS2 for rapid detection of P. aeruginosa.Exhibit a wide linear detection range 8.7 × 10 ~ 8.7 × 10(7) cfu/mL, and a low limit of detection (LOD) of 15.5 cfu/mL within 1.5 h.N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A
ABdb_1852 377516322024A novel paper-based electrochemiluminescence biosensor for non-destructive detection of pathogenic bacteria in real samplesAptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTGCTAACCCCCCTTAATCCCCCC104N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped a paper-based electrochemiluminescence (ECL) aptasensor based on a Ru-MOF-5 NFs modified Indium tin oxide (ITO) electrode for the detection of S. aureus.Exhibited a linear range from 5 to 10(8) CFU/mL, and a limit of detection (LOD) of 1 CFU/mL.N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AAfter 9 days at 4°C, the ECL signal of aptsensor retained 95.8% of its initial value, suggesting satisfactory storage stability.N/AN/AN/A
ABdb_1869 376398932024Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureusAptamer1TCGGCACGTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTC43N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs.Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry).N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A
ABdb_1870 376398932024Nano-biosensor based on manganese dioxide nanosheets and carbon dots for dual-mode determination of Staphylococcus aureusAptamer2GCGCCCTCTCACGTGGCACTCAGAGTGCCGGAAGTTCTGCGTTAT45N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped a fluorescence and colorimetry dual-mode sensor to detect S. aureus by MnO2 NSs and CDs.Had a broad linear range of 37 ∼ 3.7 × 10(6) CFU/mL and low detection limits of 9 CFU/mL (ratiometric fluorescence) and 22 CFU/mL (colorimetry).N/AN/AN/ABiosensorN/A5'-COOH (Carboxylated)N/AN/AN/AN/AN/A