Modification : 5'-Biotinylated and Cyanine3 (Cy3) Labeled

Total records found: 3

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1441	32471128	2020	Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture	A15-1	GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA	40	N/A	ssDNA	Mycoplasma Hyorhinis	Mycoplasma hyorhinis-infected cells	Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines.	A15-1 could bind to M. hyorhinis, and mixed mycoplasma-infected cells were detectable within 30 min.	N/A	Flow Cytometry	N/A	Detection	N/A	5'-Biotinylated and Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1442	32471128	2020	Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture	A16-1Y	TGGGTGGGGTTGTCGCTAGGGGTTTAAGGGGTCGTCGTGA	40	N/A	ssDNA	Mycoplasma Hyorhinis	Mycoplasma hyorhinis-infected cells	Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines.	A16-1Y could bind to M. hyorhinis and mixed mycoplasma-infected cells.	N/A	Flow Cytometry	N/A	Detection	N/A	5'-Biotinylated and Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A
ABdb_1443	32471128	2020	Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture	#1J	ATCCAGAGTGACGCAGCAGCCAACGTGCTTTCTACCTTATTTTCCGTCACTCTCACTCTGGACACGGTGGCTTAGT	76	N/A	ssDNA	Mycoplasma Hyorhinis	Mycoplasma hyorhinis-infected cells	Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines.	#1J could bind to unclassified mycoplasma-infected cells, but not M. hyorhinis-infected cells.	N/A	Flow Cytometry	N/A	Detection	N/A	5'-Biotinylated and Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A