Modification : 5'-Biotinylated and 5′-Thiolated (SH-AAAAA) and 5'-FAM Labeled

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1467	32980107	2020	A novel method combining aptamer-Ag10NPs based microfluidic biochip with bright field imaging for detection of KPC-2-expressing bacteria	XK10	GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT	61	N/A	ssDNA	Escherichia Coli expressing KPC-2 (KPC-2 E. Coli)	Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase	Developed a PDMS/glass microfluidic biochip integrated with aptamer-modified Ag(10)NPs nano-biosensors to detect whether bacteria express KPC-2.	Detects the target bacterium with a detection limit of 10(2) CFU and a capture efficiency exceeding 90% in ∼1 h.	8	Surface Plasmon Resonance (SPR)	0.81 nM	Biosensor	Protein SELEX and Whole Cell-SELEX	5'-Biotinylated and 5′-Thiolated (SH-AAAAA) and 5'-FAM Labeled	N/A	N/A	N/A	N/A	N/A