Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 29
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0539 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A2 | ATACCAGCTTATTCAATT-GATCGATCGATCAGTCAGTCGACCAACGCACGACACGCATCGCTCTATCTCGTCGAACAG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | A2 achieved 34% PBMC proliferation inhibition. | 11 | Fluorescence Spectroscopy | 26 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0633 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA1 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | 12.02 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0634 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA2 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0635 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E6-15 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0636 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-3 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0637 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-4 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0638 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E7-12 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAGTAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0639 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-5 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGTCTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0640 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E9-16 | GGGAGCTCAGAATAAACGCTCAA-CGGGCTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0641 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P6-5 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGCTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0642 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-4 | GGGAGCTCAGAATAAACGCTCAA-TACCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0643 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-8 | GGGAGCTCAGAATAAACGCTCAA-CATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0731 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL26 | TAGCTCACTCATTAGGCA-CATTTGTGGCACCAAATTTGAATTAATCAAGACAGTGTGGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | SAL 26 can detect 10(2) CFU/mL in the gold nanoparticle-based colourimetric assay and has a limit of detection (LOD) of 10(3) CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 123 ± 23 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0733 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL28 | TAGCTCACTCATTAGGCA-CTCTGTCGTCAACAGTCTAACTTGTAGAATTGATGTTACTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 195 ± 46 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0740 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL11 | TAGCTCACTCATTAGGCA-CTCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 184 ± 43 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0782 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci49 | GCCTGTTGTGAGCCTCCTAAC-TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT-CATGCTTATTCTTGTCTCC | 83 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | Display detection limit of 10(3) CFU/ml, and the sensitivity of the test toward the clinical isolates was 95.47%. | 12 | Flow Cytometry | 7.547 ± 1.353 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0783 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci55 | GCCTGTTGTGAGCCTCCTAAC-GTTACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCT-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | N/A | 12 | Flow Cytometry | 10.70 ± 2:561 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1012 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB10 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 46 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1013 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB20 | TAGCTCACTCATTAGGCAC-GCGTTACGTTAGTGGCCGCCTATGAGGACAGGCGGTTGTA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 128 ± 45 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1014 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB28 | TAGCTCACTCATTAGGCAC-TGGACGTCGTGGCGGAGGTTTTATAAAACGGCGCCACTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 49 ± 39 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1015 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB35 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCGCGATTT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 34 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1016 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB1 | TAGCTCACTCATTAGGCAC-CGGGTGGGCTCCAATATGAATCGCTTGCCCTGACGCTATCT-GCATAGTTAAGCCAGCC | 77 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 56 ± 87 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1017 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB3 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 37 ± 112 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1018 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB5 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 58 ± 14 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1019 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB9 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1020 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB21 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCAAGATG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1404 | 32685985 | 2020 | Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7 | Anti-E. coli O157:H7 aptamer | ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform. | Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples. | 15 | Bio-Layer Interferometry (BLI) | 69.73 nM | Biosensor | Microtiter Plate-based Cell SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1495 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O2 | V.ch47 | GCCTGTTGTGAGCCTCCTAAC-CGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTC-CATGCTTATTCTTGTCTCC | 79 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | Identify 10(4) CFU/ml with 25 pM of biotinylated aptamer and only 20 μg/ml of VHH without any cross-reactivity. | 12 | Flow Cytometry | 15.404 ± 4.776 pM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1786 | https://doi.org/10.1016/j.snb.2023.133745 | 2023 | Dual recognition strategy for the rapid and precise detection of Bacillus cereus using post-modified nano-MOF and aptamer | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | A dual-recognition strategy using a fluorescent probe, FcMBL-coated nano-MIL-53(Al)-NH2, for detecting B. cereus was developed. | Shows a linear range of 20–2 × 10(8) CFU/mL with a limit of detection of 4 CFU/mL within 60 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |