Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 54
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0757 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S6 | ATACCAGCTTATTCAATT-GCCGCGGAATTGTGGCTTGGTGTCGTGGTCAGGGGCTGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0758 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S12 | ATACCAGCTTATTCAATT-GCCACTGTGGACTTGTTATTCGTCTTTGCCGTCTAATTCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84%. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 79.35 ± 12.09 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0759 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S23 | ATACCAGCTTATTCAATT-GCAACAATGTTGTGTCAGCAAGTTGGTTGGCGGTGTATTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1003 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 | GTCTTGACTAGTTACGCC-GGGAACAATATGTTCAAGGGCTCTTTAAAGTTTTAGTTCGTTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | LOD was 32 ng for H63. | 8 | Isothermal Titration Calorimetry (ITC) | 3.71 x 10-7 ± 2.12 x 10-11 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1004 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | Exhibited 2.5-fold higher binding with respect to the parent H63, and H63 SL-2 M6 has an LOD of 16 ng. | 8 | Isothermal Titration Calorimetry (ITC) | 9 x 10-8 ± 2 x 10-14 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1005 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H33 | GTCTTGACTAGTTACGCC-ACACTAGAAGGTATTTACTATTCTGTGTTAACATGTACTAGCCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1006 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H66 | GTCTTGACTAGTTACGCC-AAGTTTTAATACAACTCACATTAGGGAAAGCTTGCATCCAGGCC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1007 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H70 | GTCTTGACTAGTTACGCC-CAGGACAGGTTAAAATTTTTCTGGATCCCTTTTCATTCTCCATGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1008 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H3 | GTCTTGACTAGTTACGCC-CATACACGGTTACACGTACTGGATAATGTTGATTATGCTTCTGC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1009 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H18 | GTCTTGACTAGTTACGCC-TAGAACCAAACCTTGTGTAGAAGGGCTTCTCCCGTGTGCTTTGA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1010 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H47 | GTCTTGACTAGTTACGCC-GGATGAACTGTTCCGCTGTGTATCACGCCAAAAGTCCTTATTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1011 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H48 | GTCTTGACTAGTTACGCC-CATGAAACCATCTGGTCCGCAATGGGCGCTTGGAATATTCGTCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1085 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1 | GTCTTGACTAGTTACGCC-TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1086 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2 | GTCTTGACTAGTTACGCC-TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1087 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4 | GTCTTGACTAGTTACGCC-TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1088 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13 | GTCTTGACTAGTTACGCC-TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1089 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1T | TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1090 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2T | TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1091 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4T | TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG | 45 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-4T treated bacteria yielded reduced intracellular CFU by ∼57.8%. | 8 | Isothermal Titration Calorimetry (ITC) | 1.72 ± 0.00002 μM, | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1092 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13T | TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-13T treated bacteria yielded reduced intracellular CFU by ∼45.5%. | 8 | Isothermal Titration Calorimetry (ITC) | 0.17 ± 0.00000005 μM | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1214 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10-Trunc | GGTGGTGGTGG | 11 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibited MS activity with an IC₅₀ of 251.1 nM; Ki of 230 nM; inhibited M. tb invasion into human THP-1 monocytic cells. | 10 | Surface Plasmon Resonance (SPR) | 1.9 × 10−11 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611021901 |
| ABdb_1215 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS4 | GGACCAGGTGAGTGGATGCGGGTGCGGGTGGGGGTGAGGGGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.9 × 10−9 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1216 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS5 | GCAGAGAGAGAGAAAGTGAGAAGGGCGGGGGGGAGAGGGTGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.7 × 10−6 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1217 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS6 | GGTGGGATGGGGGGGGGAGGGTAGGGTGTGCAAGTAGAGGGTC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.8 × 10−10 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1218 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10 | GGTGTGTTGACTGAGGGGGTGGGGTGGGTGGTGGTGGATATAGC | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 1.2 × 10−8 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1219 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS20 | GGGTTGTAAGAGGGAGCTGGGAGGGGTCGGGGGGGGGGGTGGC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.1 × 10−7 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1285 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA2 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA2 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity. | 9 | Flow Cytometry | 14.31 ± 4.26 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1291 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA8 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA8 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity but less potent than VA2. | 9 | Flow Cytometry | 90.00 ± 13.51 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1341 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | A1 | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Acinetobacter Baumannii | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(3) for AB. | 3 | Fluorescence Spectroscopy | 6.8 ± 1.9 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1342 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | E27 | ACAGCACCACAGACCACAGATCATACCAGTGCGGCCGTTAGCCTCGTTAATCTGGCGTTTGTCTTCCTGCC | 71 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(4) for EC. | 3 | Fluorescence Spectroscopy | 11.9 ± 3.7 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1343 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | O28 | GGGGAAGACAAACACCTCATAGTCGGTATCGGCCGTTTGGGCGTTTTTCCGATGGTCTGTGGTGCTGT | 68 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(5) CFU/μL for MRSA. | 3 | Fluorescence Spectroscopy | 199.6 ± 35.8 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1792 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt (mono-apt) | GAGAGAGAATATAAGGGAAAAAAAAAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | N/A | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 389.63 nM (with mono-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1793 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt1 (multi-apt) | GAAGTGTACGTAGCCTGATTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1794 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt2 (multi-apt) | TCGTCTACACTACTGCTCTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1795 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt3 (multi-apt) | TCTCCAATGACGTACCTGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1796 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt4 (multi-apt) | GTTGCAGTACTCTACGAGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1797 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt5 (multi-apt) | TGTACTGGACAAGTGACGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1884 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-6 | GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Outer membrane protein BamA (β-barrel assembly machinery A) | Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells. | WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load. | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 16.23 ± 5.84 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h. | Best Candidate | N/A | N/A |
| ABdb_1885 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-26 | GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.33 ± 8.12 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1886 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-17 | GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 17.11 ± 6.35 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1887 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-32 | GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 13.08 ± 2.97 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1888 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-44 | GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.03 ± 4.2 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |