AptBacterialDB

Modification : 5'-Biotinylated (biotin-C6)

Total records found: 9

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0141 224445662012Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureusAptamer1TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 50761)Whole cellDeveloped a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2).Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 5 cfu/mL for S. Typhimurium.N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_0142 224445662012Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureusAptamer2GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2).Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 8 cfu/mL for S. aureus.N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_0454 https://doi.org/10.1016/j.foodcont.2013.09.0462014A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labelingAptamer 1TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761)Whole cellDeveloped a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium.Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL.N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_0457 249138712014A sensitive gold nanoparticle-based colorimetric aptasensor for Staphylococcus aureusS. aureus aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus) (ATCC 29213)Whole cellDeveloped a gold nanoparticle-based colorimetric aptasensor for S. aureus using tyramine signal amplification (TSA) technology.Exhibited a linear detection range from 10 to 10⁶ cfu/mL with a limit of detection (LOD) of 9 cfu/mL.N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_0466 244919612014Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplificationCapture-aptamer (c-aptamer)TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT89N/AssDNASalmonella Typhimurium (S. Typhimurium)Outer membrane protein (OMP)The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis.As low as 10(1) CFU of S. enteritidis per mL was detected.N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_0703 https://doi.org/10.1080/00032719.2015.10362782015Aptamer Immobilized Magnetoelastic Sensor for the Determination of Staphylococcus aureusS. aureus aptamer.GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDevelop an aptamer-based magnetoelastic sensor for the detection of S. aureus.Linear dynamic range of 10^1–10^11 cfu/mL and detection limit of 5 cfu/mL.N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_1225 312163062019Aptamer-based fluorometric determination of Salmonella Typhimurium using Fe3O4 magnetic separation and CdTe quantum dotsAptamer (ssDNA1)TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG40N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028)Outer membrane protein (OMP)Develop an aptamer-based (Apt-MNPs) fluorescence assay for the determination of Salmonella Typhimurium.Exhibit a linear range of 10 to 10(10) cfu/mL with LOD of 1 cfu/mL within 2 h, and is successfully applied to the analysis of spiked food samples with good recoveries from 90% to 105%.N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_1588 347535772021An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tagsS. aureus-aptamerGCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDeveloped an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection.The LOD for S. aureus was 3 cells/mL and a favorable linear relation (10-10(7) cells/mL).N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A
ABdb_1589 347535772021An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tagsL. mono-aptamerATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT47N/AssDNAListeria MonocytogenesWhole cellDeveloped an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection.The LOD for L. mono was 5 cells/mL and a favorable linear relation (10-10(7) cells/mL).N/AN/AN/ABiosensorN/A5'-Biotinylated (biotin-C6)N/AN/AN/AN/AN/A