Search
Basic Search Advanced Search Structure SearchBrowse
Browse by SELEX Method Browse by Target Browse by Organism Browse by Affinity Method Browse by Modifications Browse by Activity Role Browse by Year Browse by LengthTools
BLASTN GC Calculator Knowledge Graph Downloads API Cross ReferencingInformation
Statistics User GuideDevelopers
Team ContactTotal records found: 312
Download:
| AptBacDB_ID ⇅ | PMID/DOI ⇅ | Year ⇅ | Title ⇅ | Aptamer name ⇅ | Sequence (5′ to 3′) ⇅ | Length ⇅ | Library ⇅ | Type ⇅ | Target Organism ⇅ | Target ⇅ | Objective/Mechanism ⇅ | Outcome/Inhibitory effect ⇅ | No. of selection round SELEX ⇅ | Determination of affinity method ⇅ | Kd value ⇅ | Activity Role ⇅ | Method ⇅ | Modification ⇅ | Cytotoxicity (cell viability) ⇅ | Stability⇅ | Potential Candidate ⇅ | Half-life ⇅ | Patent ⇅ |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ABdb_0026 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1F | ATCCGTCACCCCTGCTCTCGTCGCTATGAAGTAACAAAGATAGGAGCAATCGGGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0027 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3F | ATCCGTCACACCTGCTCTAACGAAGACTGAAACCAAAGCAGTGACAGTGCTGAATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0028 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4F | ATCCGTCACACCTGCTCTCGGTGACAATAGCTCGATCAGCCCAAAGTCGTCAGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0029 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6F | ATCCGTCACACCTGCTCTAACGAAATAGACCACAAATCGATACTTTATGTTATTGGTGTTGGCTCCCGTAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0030 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7F | ATCCGTCACACCTGCTCTGTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0031 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8F | ATCCGTCACACCTGCTCTTAAGCCGAGGGGTAAATCTAGGACAGGGGTCCATGATGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0032 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9F | ATCCGTCACACCTGCTCTACTGGCCGGCTCAGCATGACTAAGAAGGAAGTTATGTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0033 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10F | ATCCGTCACACCTGCTCTGGTACGAATCACAGGGGATGCTGGAAGCTTGGCTCTTGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0034 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L1R | ATACGGGAGCCAACACCACCCGATTGCTCCTATCTTTGTTACTTCATAGCGACGAGAGCAGGGGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0035 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L3R | ATACGGGAGCCAACACCATTCAGCACTGTCACTGCTTTGGTTTCAGTCTTCGTTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0036 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L4R | ATACGGGAGCCAACACCATCTGACGACTTTGGGCTGATCGAGCTATTGTCACCGAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0037 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L6R | ATACGGGAGCCAACACCAATAACATAAAGTATCGATTTGTGGTCTATTTCGTTAGAGCAGGTGTGACGGAT | 71 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0038 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L7R | ATACGGGAGCCAACACCATCCCTGCTAACAACTCTTCCAGGCAGAGCATTCGACAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0039 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L8R | ATACGGGAGCCAACACCATCATGGACCCCTGTCCTAGATTTACCCCTCGGCTTAAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0040 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L9R | ATACGGGAGCCAACACCACATAACTTCCTTCTTAGTCATGCTGAGCCGGCCAGTAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0041 | 18759112 | 2008 | In vitro antibacterial effects of antilipopolysaccharide DNA aptamer-C1qrs complexes | L10R | ATACGGGAGCCAACACCAAGAGCCAAGCTTCCAGCATCCCCTGTGATTCGTACCAGAGCAGGTGTGACGGAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) O111:B4 and K12 strains | Lipopolysaccharide (LPS) and Whole cell | Identify aptamers against LPS and develop Apt-C1qrs complexes to inhibit bacterial growth by triggering the classical complement cascade and rapid passive immunity. | Significantly reduced the colony counts when applied to E. coli O111:B4 and K12 strains across a series of 10× dilutions of the bacteria. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0054 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2F | CATCCGTCACACCTGCTCTG-GTTCGCCCCGGTCAAGGAGA-GTGGTGTTGGCTCCCGTATC | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0055 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5R | GATACGGGAGCCAACACCAC-TAACTTGTTGCTGATCTTAT-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | Increase in phagocytic index (P.I.) up to threefold in the first 30 min of exposure to α-PDGA-MBs. | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | Best Candidate | N/A | N/A |
| ABdb_0056 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 2R | GATACGGGAGCCAACACCAC-TCTCCTTGACCGGGGCGAAC-CAGAGCAGGTGTGACGGATG | 60 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0057 | 18671260 | 2009 | Preliminary development of DNA aptamer-Fc conjugate opsonins | α-PDGA 5F | CATCCGTCACACCTGCTCTG-GATAAGATCAGCAACAAGTTA-GTGGTGTTGGCTCCCGTATC | 61 | 5'-CATCCGTCACACCTGCTCTG-N20-GTGGTGTTGGCTCCCGTATC-3' | ssDNA | Bacillus Anthracis (BA) | Poly-alpha-D-glutamic acid (α-PDGA-coated magnetic beads (MBs)) part of the B.anthracis capsule | Identify aptamers against α-PDGA-MBs and couple them to Fc fragments of murine IgG DNA to act as potential opsonins. | N/A | 5 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Therapeutics | Magnetic Bead (MB)-based SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | Cell viability ranged from 90% to 95% in all experiments. | N/A | N/A | N/A | N/A |
| ABdb_0074 | 19234874 | 2009 | Aptamer-based electrochemical biosensor for Botulinum neurotoxin | BoNT/A aptamer | ATACCAGCTTATTCAATTGACATGACTGGGATTTTTGGCGAAATCGAAGGAAGCGGAGAGATAGTAAGTGCAATCT | 76 | N/A | ssDNA | Clostridium Botulinum | Botulinum neurotoxins (BoNT)-light chain of type A (BoNT/A) toxoid | Developed an aptamer-based electrochemical sensor for the detection of Botulinum neurotoxin. | Achieved a limit of detection (LOD) of 40 pg/ml within 24 h. | N/A | N/A | 3.0 ± 0.8 × 10(9) M−1 | Biosensor | Single micro-bead SELEX | 5'-Biotinylated and 3'-Fluorescein Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0080 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 4R | ATCCGTCACACCTGCTCT-ACGGCGCTCCCAACAGGCCTCTCCTTACGGCATATTA-TGGTGTTGGCTCCCGTAT | 73 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | Detect as few as 30 live, unlabeled E. coli per ml using FRET assay. | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0081 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 3R | ATCCGTCACACCTGCTCT-GTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCG-TGGTGTTGGCTCCCGTAT | 72 | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0082 | 20443050 | 2010 | A novel screening method for competitive FRET-aptamers applied to E. coli assay development | EcO 8F | ATACGGGAGCCAACACCA-CGACTAACACGACCGTTGGGGGGGGCTCGCGCGGGC-AGAGCAGGTGTGACGGAT | 72 | 5'-ATACGGGAGCCAACACCA-N36-AGAGCAGGTGTGACGGAT-3' | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) | Outer membrane protein (OMP) | Identify highly effective DNA aptamers for detecting E. coli outer membrane proteins. | N/A | 5 | Fluorescence Resonance Energy Transfer Assay (FRET) and Enzyme-Linked Aptamer Assay (ELAA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated and AlexaFluor 647 Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0085 | 21381755 | 2011 | Aptamer-mediated inhibition of Mycobacterium tuberculosis polyphosphate kinase 2 | PPK2 G9 | CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-AACACATAGGTTTGGTTAGGTTGGTTGGTTGAATTA-AAGCTTTGCAGAGAGGATCCTT | 99 | 5'-CCGTAATACGACTCACTATAGGGGAGCTCGGTACCGAATTC-N35-AAGCTTTGCAGAGAGGATCCTT-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 93009) | PPK2 Enzyme | Identify aptamers that bind to and inhibit the catalytic activities of enzyme PPK2. | Inhibited PPK2 protein with an IC50 of 39.3 ± 10 nM and inhibited the NDK activities of both the LHK and VC PPK2 proteins with IC50 values of >1 μM and 105 ± 5 nM, respectively. | 20 | Isothermal Titration Calorimetry (ITC) | 870 ± 220 nM | Therapeutics | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0123 | 21875107 | 2011 | Identification of environmental reservoirs of nontyphoidal salmonellosis: aptamer-assisted bioconcentration and subsequent detection of salmonella typhimurium by quantitative polymerase chain reaction | Sal aptamer | CTCACCAGGAGATTACAACATGG-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-AGCTCAGACCAAAAGTGACCATC | 86 | 5'-CTCACCAGGAGATTACAACATGG-N40-AGCTCAGACCAAAAGTGACCATC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Detection of Salmonella Typhimurium by serovar-specific DNA aptamer-conjugated dynabeads in water samples. | Sediments from the selected sampling locations also exhibit Salmonella Typhimurium in the range of 3.37 × 10(4) to 3.08 × 10(9) cfu/100 g. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0132 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB1) | GGTATTGAGGGTCGCATC-CACTGGTCGTTGTTGTCTGTTGTCTGTTATGTTGTTTCGT-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | Have an affinity and high selectivity for SEB. | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0133 | 22438927 | 2012 | A single-stranded DNA aptamer that selectively binds to Staphylococcus aureus enterotoxin B | APT(SEB2) | GGTATTGAGGGTCGCATC-CCGTAGTGTGTTCTTATTCGTGTCTGTGTGTGTTCTGTCG-GATGGCTCTAACTCTCCTCT | 78 | 5'-GGTATTGAGGGTCGCATC-N40-GATGGCTCTAACTCTCCTCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to SEB and quantification of all of the SEs in S. aureus contaminated food. | N/A | 14 | N/A | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0138 | 22520654 | 2012 | Evaluation of the clinical value of ELISA based on MPT64 antibody aptamer for serological diagnosis of pulmonary tuberculosis | MPT64-A1 | GGGAGCTCAGAATAAACGCTCAAA-GGGAGCTCAGAATAAACGCTCAAAAACGCTCAAGAGGCCCGGATCTTCGACATGAGGCCCGGATC-CGACATGAGGCCCGGATC | 107 | 5'-GGGAGCTCAGAATAAACGCTCAAA-N35-CGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | MPT64 antibody | Identify aptamers against MPT64 antibody and develop a sandwich ELISA for the serological diagnosis of pulmonary TB (PTB). | LOD was 2.5 mg/L, with a linear range varying from 10 mg/L to 800 mg/L. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0141 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 50761) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 5 cfu/mL for S. Typhimurium. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0142 | 22444566 | 2012 | Dual-color upconversion fluorescence and aptamer-functionalized magnetic nanoparticles-based bioassay for the simultaneous detection of Salmonella Typhimurium and Staphylococcus aureus | Aptamer2 | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a luminescent bioassay for the simultaneous detection of S. Typhimurium and S. aureus using aptamer-conjugated MNPs and UCNPs (NaY0.78F4:Yb0.2, Tm0.02 UCNPs modified aptamer 1 and NaY0.28F4:Yb0.70, Er0.02 UCNPs modified aptamer 2). | Display linear range of 10(1)-10(5) cfu/mL with a limit of detection of 8 cfu/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0185 | 22226327 | 2012 | Bio-capture of S. Typhimurium from surface water by aptamer for culture-free quantification | Sal aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-based bio-capture assay for the detection of selective serovar species through molecular-beacon-based real-time PCR. | Achieved a detection limit of 1 CFU/PCR or 100 CFU/ml. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0238 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA1 | ATCCAGACGTGACGCAGC-ATGCGGTTGGTTGCGGTTGGGCATGATGTATTTCTGTG-TGGACACGGTGGCTTAGTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.6 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0239 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA2 | ATCCAGAGTGACGCAGCA-CGACACGTTAGGTTGGTTAGGTTGGTTAGTTTCTTG-TGGACACGGTGGCTTA | 70 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 2.0 ± 0.6 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0240 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA3 | ATCCAGAGTGACGCAGCA-GTAGATGGTTTGGTTGGTGTGGTTTCCTACTGATGTTGGG-TGGACACGGTGGCTTAGTA | 77 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA1 and DTMRSA3 showed the best specificity for MRSA. | 17 | Flow Cytometry | 1.3 ± 0.5 × 10(2) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0241 | 25436184 | 2013 | Molecular recognition of live methicillin-resistant staphylococcus aureus cells using DNA aptamers | DTMRSA4 | ATCCAGAGTGACGCAGCA-TTATGGGGTGTGGTGGGGGGTTAATGCGTTGGTTATCCG-TGTGGACACGGTGGCTTA | 75 | 5'-ATCCAGAGTGACGCAGCA-N40-TGGACACGGTGGCTTAGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers against MRSA and conjugate them to AuNPs for their detection. | DTMRSA2 and DTMRSA4 bound to all three types of clinical bacterial strains. | 17 | Flow Cytometry | 9.5 ± 2 × 10(1) nM | Detection | Whole Cell-SELEX | 5'-Biotinylated or FITC Labeled or Thiolated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0250 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-17 | AGTATACGTATTACCTGCAGC-GAGGGAAGAAGGGCCAGCACAGATCAGATCAATCGCTCCG-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | Lbi-17 showed maximum binding of 78.7 ± 12.38% with an LOD of the combined AMC-qPCR method of 1.8 log10 CFU/500μl L.monocytogenes and ranged from 26% to 77%. | 6 | Flow Cytometry | 35.7 ± 8.02 μM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0251 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-16 | AGTATACGTATTACCTGCAGC-AAATACTTTAGATCTAAGAGTGTTTCGAAAAGACAACAGA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0252 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-118 | AGTATACGTATTACCTGCAGC-TTGAATTAATAGATTAGTATACTTGGGAATCGTCCTAATA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0253 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-200 | AGTATACGTATTACCTGCAGC-AGGAAGACAAATTCCGCCAAAAAGTGGATATAACCAATAA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0254 | 23942378 | 2013 | Nucleic acid aptamers for capture and detection of Listeria spp | Lbi-203 | AGTATACGTATTACCTGCAGC-ATAGAGTAGAAGCTACACTACGTAATCACAGACAGATCCA-CGATATCTCGGAGATCTTGC | 81 | 5'-AGTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Identify aptamers against Listeria spp. and develop aptamer-mediated magnetic capture (AMC) for detecting these bacteria. | N/A | 6 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0273 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 | GGGAGAGCGGAAGCGUGCUGGG-UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA-CAUAACCCAGAGGUCGAUGGUCCCC | 89 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 20.27 ± 4.372 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0274 | 23676911 | 2013 | In vitro selection of RNA aptamer specific to Salmonella typhimurium | Clone I-2 Truncated 43-mer | GUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGAC | 39 | 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40-CAUAACCCAGAGGUCGAUGGAUCCCC-3' | ssRNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 15277) | OmpC protein | Identify an RNase-resistant RNA aptamer that binds to the OmpC protein of S. Typhimurium. | Bound only to Sal.Typhimurium, but not to S. aureus, E. coli O157:H7 and to that does not express the OmpC protein. | 5 | Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) | 27.64 ± 4.784 nM | Detection | SELEX | 2'-Fluoro pyrimidines (2'-F-RNA) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0331 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-7 | GTATACGTATTACCTGCAGC-CTGATGTGTGGGTAGGTGTCGTTGATTTCTTCTGGTGGGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | N/A | 10 | Flow Cytometry | 1.73±0.54 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0332 | 23494620 | 2013 | Selection of DNA aptamers for capture and detection of Salmonella Typhimurium using a whole-cell SELEX approach in conjunction with cell sorting | S8-46 | GTATACGTATTACCTGCAGC-CTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG-CGATATCTCGGAGATCTTGC | 80 | 5'-GTATACGTATTACCTGCAGC-N40-CGATATCTCGGAGATCTTGC-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) (Strain S913) | Whole cell | Identifying aptamers selected by whole-cell SELEX and developing a qPCR-based capture-detection platform for Salmonella Typhimurium. | Achieved a Lower Limit of Detection (LOD) of 10(2)-10(3) CFU in a 290-μl sample, and the mean capture efficiency ranged from 3.6% to 12.6%. | 10 | Flow Cytometry | 0.74±0.20 μM | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0396 | 24018905 | 2014 | Simultaneous improvement of specificity and affinity of aptamers against Streptococcus mutans by in silico maturation for biosensor development | SMa#G6-25 | GGATCTGGTTAGTGAAGAGGGGGGAGGGGGGGTTGGGCTGTGGGGCGGTTAGTCGT | 56 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175 and JCM 5175) | Whole cell | Improvement of affinity and specificity of aptamers against S. mutans using ISM and detection by aptamer-immobilised gold colloids. | N/A | 6 | Flow Cytometry | N/A | Detection | In Silico Maturation (ISM) | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0417 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT17 | CGCGTCAGAGGTGTGTCGGGGCTGTGTAGATCTACATGGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0418 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT12 | CAGTCGCTTTCCGTTCTCCGGCAGGTTCATTGTGGTTTCG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0419 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT11 | CATATCAGGTCGTCACCGTAACAGAGCTCTCGCAATCACG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0420 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT9 | CAAAGGCAGCAGTAGCATGGCGATTTACATCAATTATTGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0421 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT8 | CAATATCAGAAGTAGCGCGAAGGACGACATGTCAGGAAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0422 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT7 | CACACATCCTCGCAGCCTCGTACCTGATTCCAGTCTATTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0423 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT6 | CCAGGAAGGCGAGAGCCGAGAAGCGATCCTTGGGTATAGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0424 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5 | CGGCATCCGTTCACGTACCTGTCCTAGTTATCACCGTTTG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0425 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT5.1 | CAAGCAGAGTTCCGAGACACAGTACCACACGCATATCCGG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0426 | 25536105 | 2014 | A combined enrichment and aptamer pulldown assay for Francisella tularensis detection in food and environmental matrices | FT4 | CACACAGAGACGGTGAAGGCGCCGACCAGTTCCTAAAGAG | 40 | WAP40m | ssDNA | Francisella Tularensis | Whole cell | Developed a two-step enrichment process using DNA aptamer cocktail for improved cultivation and detection of F. tularensis in lettuce and soil. | This two-step approach resulted in a lower limit of detection from a starting inoculum of 1 cell/mL. | 11 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0454 | https://doi.org/10.1016/j.foodcont.2013.09.046 | 2014 | A visual detection method for Salmonella Typhimurium based on aptamer recognition and nanogold labeling | Aptamer 1 | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (ATCC 50761) | Whole cell | Developed a sandwich detection method based on the recognition of aptamers coupled with nanogold labelling and silver signal amplification for the detection of Salmonella Typhimurium. | Obtained a linear range of 10-10(6) cfu/mL, and the detection limit was observed to be 7 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0457 | 24913871 | 2014 | A sensitive gold nanoparticle-based colorimetric aptasensor for Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 29213) | Whole cell | Developed a gold nanoparticle-based colorimetric aptasensor for S. aureus using tyramine signal amplification (TSA) technology. | Exhibited a linear detection range from 10 to 10⁶ cfu/mL with a limit of detection (LOD) of 9 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0458 | 25188392 | 2014 | Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella Typhimurium | STM-binding aptamer | ATCCGTCACACCTGCTCTGGAGCAATATGGTGGAGAAACGTGGTGTTGGCTCCCGTAT | 58 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115) | Whole cell | Develop a gold nanoparticle-based enzyme-linked antibody-aptamer sandwich (nano-ELAAS) method for quantitative detection of STM. | Quantitative detection range: 1 × 10³ to 1 × 10⁸ CFU/mL and LOD: 1 × 10³ CFU/mL, and a selectivity of >10-fold for STM in samples containing other bacteria at higher concentration, with an assay time of less than 3 h. | N/A | LPS-Aptamer Plate Binding Assay | 19.59 ± 0.35 nM | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled and 5'-Biotinylated | N/A | MMP-aptamers and nanoprobes were stored at 4°C for 2 weeks, no obvious change of the S/B was observed. | N/A | N/A | N/A |
| ABdb_0459 | 25437803 | 2014 | Application of DNA Aptamers and Quantum Dots to Lateral Flow Test Strips for Detection of Foodborne Pathogens with Improved Sensitivity versus Colloidal Gold | EcO 3R | CACACCTGCTCTGTCTGCGAGCGGGGCGCGGGCCCGGCGGGGGATGCGTGGTGTTGGCTC | 60 | N/A | ssDNA | Escherichia Coli (E. Coli) strain 8739 (Crooks strain) and Escherichia Coli (E. Coli) O157:H7 | Whole cell | Sandwich (EcO 3R/4F) Lateral Flow Assay (aptamer-Qdot LF strip) for the detection of E.coli. | Sandwich combination (EcO 3R-conjugate and EcO 4F-capture aptamer) yielded a visible limit of detection (LOD) of ~3,000 E. coli 8739 and ~6,000 E. coli O157:H7 in buffer. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3′-DIG (Digoxigenin) Labeled | N/A | N/A | N/A | N/A | U.S. Patent Application 13/136,820 |
| ABdb_0466 | 24491961 | 2014 | Lateral flow biosensor for DNA extraction-free detection of Salmonella based on aptamer mediated strand displacement amplification | Capture-aptamer (c-aptamer) | TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGTCCAGAAGCCGAACAAGCTGAGGATGAAGAACAACGGCT | 89 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Outer membrane protein (OMP) | The gold-nanoparticle-based lateral flow biosensor was developed for the rapid detection of S. enteritidis. | As low as 10(1) CFU of S. enteritidis per mL was detected. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0527 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt1 | ATGCGGATCCCGCGC-CGAGTGAGGGCGAGGCGCGCTCCTGCCGGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | IC₅₀ of 28.94 ± 0.002 nM and showed a MIC of 5.36 μg/ml against MDR (M22, M23, and P887) and XDR (X24, X59) strains. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.06 ± 0.10 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0528 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt6 | ATGCGGATCCCGCGC-CGGCCAGGGGACGAGCGCGCCCTGATCGTG-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | IC₅₀of 22.35 ± 0.001 nM and showed MIC of 6.24 μg/ml against MDR (M22, M23, and P887) and XDR (X24, X59) strains. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.210 ± 0.05 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0529 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Apt1_M3 (17-mer) | ATGCGGATCCCGCGC-GAGGGCGAGGCGCGCTC-GCGCAAGCTTCGCGC | 47 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Significant growth inhibition against MDR-TB and XDR-TB strains of tuberculosis with a very low MIC of 5.36 μg/ml. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 4.90 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | Mtb-Apt1 (17-mer) and Mtb-Apt6 (20-mer) do not exhibit significant toxicity at the tested concentrations ranging from 0 to 20 μM. | N/A | N/A | N/A | N/A |
| ABdb_0530 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Apt6_M3 (20-mer) | ATGCGGATCCCGCGC-CAGGGGACGAGCGCGCCCTG-GCGCAAGCTTCGCGC | 50 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Significant growth inhibition against MDR-TB and XDR-TB strains of tuberculosis with a very low MIC of 6.24 μg/ml. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 364 nM | Therapeutics | DNA-SELEX | 5'-Biotinylated | Mtb-Apt1 (17-mer) and Mtb-Apt6 (20-mer) do not exhibit significant toxicity at the tested concentrations ranging from 0 to 20 μM. | N/A | Best Candidate | N/A | N/A |
| ABdb_0531 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt2 | ATGCGGATCCCGCGC-GGCACCCAGTGTGGCGCGCCTCCCTCCGTC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.286 ± 0.64 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0532 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt3 | ATGCGGATCCCGCGC-GCCCACCTGTGGGGCGCGCCTCCCTCCGTC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Showed moderate to lower inhibition specificities. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.677 ± 0.14 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0533 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt4 | ATGCGGATCCCGCGC-GCCCACGTGTGGTGCGCGCCTCCTCGTAGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | Showed moderate to lower inhibition specificities. | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.956 ± 0.20 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0534 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt5 | ATGCGGATCCCGCGC-GGCACCCAGTGTGGCGCGCCTCCTCGTAGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.03 ± 0.12 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0535 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt7 | ATGCGGATCCCGCGC-ACGCGACAGCAGTGCGCGCCCCGTCCCGGT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.02 ± 0.13 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0536 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt8 | ATGCGGATCCCGCGC-CGACGGAGGGAGGCGCGCCACACTGGGTGC-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 0.55 ± 0.05 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0537 | 25988243 | 2015 | Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase | Mtb-Apt9 | ATGCGGATCCCGCGC-GCACCGGCAGGAGCGCGCCTCGCCCTCACT-GCGCAAGCTTCGCGC | 60 | 5'-ATGCGGATCCCGCGC-N30-GCGCAAGCTTCGCGC-3' | ssDNA | Mycobacterium Tuberculosis MDR (M22, M23, and P887) strains and XDR (X24, X59) strains | Acetohydroxyacid synthase (AHAS) | Identify aptamers that bind to and inhibit the activity of the AHAS enzyme and bacterial growth. | N/A | 10 | Enzyme-Linked Immunosorbent Assay (ELISA) | 1.66 ± 0.22 μM | Therapeutics | DNA-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0538 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A11 | ATACCAGCTTATTCAATT-TAGGCGGTGGAGATAGTAAGTGCAATCTAGGCGGTGGAGATAGTAAGTGCAATCTATGCC-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | Inhibited SEB-mediated PBMC proliferation of 93% and TNF-α, IL-1β, IL-6, IL-2, and IFN-γ in culture supernatants were reduced by 77, 97, 64, 96, and 99%, respectively. 90% survival of mouse models of SEB-induced TSS. | 11 | Fluorescence Spectroscopy | 64 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FITC Labeled | Showed no cytotoxic effects on PBMCs. | N/A | N/A | N/A | N/A |
| ABdb_0539 | 25624325 | 2015 | Neutralization of staphylococcal enterotoxin B by an aptamer antagonist | A2 | ATACCAGCTTATTCAATT-GATCGATCGATCAGTCAGTCGACCAACGCACGACACGCATCGCTCTATCTCGTCGAACAG-AGATAGTAAGTGCAATCT | 96 | 5'-ATACCAGCTTATTCAATT-N60-AGATAGTAAGTGCAATCT3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and block SEB-mediated toxic shock (TSS) in vitro. | A2 achieved 34% PBMC proliferation inhibition. | 11 | Fluorescence Spectroscopy | 26 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0626 | 25562742 | 2015 | Aptamer-conjugated silver nanoparticles for electrochemical dual-aptamer-based sandwich detection of staphylococcus aureus | Primary anti-S.aureus aptamer | TCCCTACGGCGCTAACCCCCCCAGTCCGTCCTCCCAGCCTCACACCGCCACCGTGCTACAAC | 62 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Dual-aptamer-based sandwich immunosensor (Apt/S.aureus/apt-AgNP) for the detection of S. aureus. | Display a dynamic range from 10 to 1×10(6) cfu/mL with a low detection limit of 1.0 cfu/mL. | 2 | N/A | 35 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0633 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA1 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | 12.02 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0634 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | MA2 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | Sandwich ELISA based on MA2 and MA1 display a linear range of 8 × 10(4) to 128 × 10(4) CFU with the detection limit of 1 × 10(4) CFU. | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0635 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E6-15 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0636 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-3 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACCGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0637 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-4 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0638 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E7-12 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAGTAGACTGGTGGCTCTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0639 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P9-5 | GGGAGCTCAGAATAAACGCTCAA-CGGATTAGTCAATAGTCTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0640 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | E9-16 | GGGAGCTCAGAATAAACGCTCAA-CGGGCTAGTCAATAGACTGGTGGCTTTGTGTGGTG-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0641 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P6-5 | GGGAGCTCAGAATAAACGCTCAA-TATCCCTATTCCGCTCCATGCTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0642 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-4 | GGGAGCTCAGAATAAACGCTCAA-TACCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0643 | 26194558 | 2015 | Identification and application of ssDNA aptamers against H₃₇Rv in the detection of Mycobacterium tuberculosis | P10-8 | GGGAGCTCAGAATAAACGCTCAA-CATCCCTATTCCGCTCCATGTTGCGTACCCGTGCC-TTCGACATGAGGCCCGGATC | 78 | 5'-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) (ATCC 27294) | Whole cell | Identify aptamers to effectively capture or discriminate MTB strains. | N/A | 10 | Bio-Layer Interferometry (BLI) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0656 | 26636098 | 2015 | Selection of Single-Stranded DNA Molecular Recognition Elements against Exotoxin A Using a Novel Decoy-SELEX Method and Sensitive Detection of Exotoxin A in Human Serum | R14.33 | TGTACCGTCTGAGCGATTCGTAC-CATAGGGTGCTTTTCAAGGCCACACGTTAGTGTA-AGCCAGTCAGTGTTAAGGAGTGC | 80 | 5'-TGTACCGTCTGAGCGATTCGTAC-34N-AGCCAGTCAGTGTTAAGGAGTGC-3' | ssDNA | Pseudomonas Aeruginosa | Exotoxin A | Identify ssDNA MREs against Exotoxin A and develop a sandwich ELISA for its detection in human serum. | 100 nM or 6.6 μg/mL of Exotoxin A in human serum was detected. | 14 | Surface Plasmon Resonance (SPR) | 4.2 and 4.5 μM | Diagnostic | Decoy-SELEX | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0693 | 26302256 | 2015 | Colorimetric Aptasensor Based on Enzyme for the Detection of Vibrio parahemolyticus | Apt 2 | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed a colorimetric aptasensor system based on sandwich-type complex (AuNPs−HRP−aptamer−target−aptamer−MNPs) to detect V. parahemolyticus. | Linear detection range: 10 to 10^6 cfu/mL, with a limit of detection (LOD) of 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0703 | https://doi.org/10.1080/00032719.2015.1036278 | 2015 | Aptamer Immobilized Magnetoelastic Sensor for the Determination of Staphylococcus aureus | S. aureus aptamer. | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Develop an aptamer-based magnetoelastic sensor for the detection of S. aureus. | Linear dynamic range of 10^1–10^11 cfu/mL and detection limit of 5 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0731 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL26 | TAGCTCACTCATTAGGCA-CATTTGTGGCACCAAATTTGAATTAATCAAGACAGTGTGGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | SAL 26 can detect 10(2) CFU/mL in the gold nanoparticle-based colourimetric assay and has a limit of detection (LOD) of 10(3) CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 123 ± 23 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0733 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL28 | TAGCTCACTCATTAGGCA-CTCTGTCGTCAACAGTCTAACTTGTAGAATTGATGTTACTG-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 195 ± 46 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0740 | 27070414 | 2016 | Selection and Characterization of Aptamers Using a Modified Whole Cell Bacterium SELEX for the Detection of Salmonella enterica Serovar Typhimurium | SAL11 | TAGCTCACTCATTAGGCA-CTCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC 3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Identify an aptamer and develop a nanogold-based colourimetric method or sedimentation assay for detecting Salmonella enterica serovar Typhimurium cells. | Limit of detection (LOD) of 10(3)CFU/mL in the aptamer sedimentation assay. | 10 | Fluorescence Spectroscopy | 184 ± 43 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0756 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S3 | ATACCAGCTTATTCAATT-CCCGCCTCTGAGCATTATTAATGTTATACCTTACGGCTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84% and reduced IFN-γ, TNF-α, IL-2, and IL-6 secretions by 89%, 87%, 73%, 69%, respectively. PEGS3 allowed 79% of the mice to survive the lethal challenge. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 36.93 ± 7.29 nM | Therapeutics/Immunmodulatory | SELEX | 5′-Polyethylene glycol (PEG) with 5'-Amidation (NH₂) and 3’-Inverted Thymidine (3'-idT) and 5'-Biotinylated or 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0757 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S6 | ATACCAGCTTATTCAATT-GCCGCGGAATTGTGGCTTGGTGTCGTGGTCAGGGGCTGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0758 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S12 | ATACCAGCTTATTCAATT-GCCACTGTGGACTTGTTATTCGTCTTTGCCGTCTAATTCG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | Inhibited PBMCs proliferation with an inhibition rate of 84%. | 9 | Enzyme-Linked Aptamer Assay (ELAA) | 79.35 ± 12.09 nM | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0759 | 27179422 | 2016 | Inhibition of the superantigenic activities of Staphylococcal enterotoxin A by an aptamer antagonist | S23 | ATACCAGCTTATTCAATT-GCAACAATGTTGTGTCAGCAAGTTGGTTGGCGGTGTATTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin A (SEA) | Identify aptamers that bind to and block superantigen activity of SEA. | N/A | 9 | Enzyme-Linked Aptamer Assay (ELAA) | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0782 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci49 | GCCTGTTGTGAGCCTCCTAAC-TACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCTACTGT-CATGCTTATTCTTGTCTCC | 83 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | Display detection limit of 10(3) CFU/ml, and the sensitivity of the test toward the clinical isolates was 95.47%. | 12 | Flow Cytometry | 7.547 ± 1.353 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0783 | 27234880 | 2016 | Aptamer-nanobody based ELASA for specific detection of Acinetobacter baumannii isolates | Aci55 | GCCTGTTGTGAGCCTCCTAAC-GTTACATGGTCAACCAAATTCTTGCAAATTCTGCATTCCT-CATGCTTATTCTTGTCTCC | 80 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Acinetobacter Baumannii (ATCC 19606) | Whole cell | Identify aptamers against and develop a sandwich enzyme-linked aptamer sorbent assay (ELASA) for the rapid detection of A. baumannii from clinical isolates. | N/A | 12 | Flow Cytometry | 10.70 ± 2:561 pM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_0796 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC2 | TGCAGGATCCGGTATCCGTGGACGGTGTGCAGGATCCGGTATCCGTGGGCACGAGAATTCCTCCGTTGCG | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | LOD in the minimum quantity of 5 ng SEB per 100 µl of human serum. | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | 2.3 × 10(−11) M | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0797 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC3 | TGCAGGATCCGGTATCCGTGCACACACACCCAACAACCAGCTGCCGCACCGGAGGAATTCTCGT | 64 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0798 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC7 | TGCAGGATCCGGTATCCGTGGGCGGGGCCATGCAGGATCCGGTATCCGTGGGCCGCAACGGAGGAATCTCGT | 72 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0799 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC8 | CCGTGGCCGCAACGGAGGAATTCTCGT | 27 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0800 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC9 | ACGAGAATTCCTCCGTTGCGGCACAGTTGGGCAGGAACCTGTGGGGCGTGCGCAACGGAGGAATTCTCGT | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0801 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC10 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACC | 33 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0802 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC11 | TGCAGGATCCGGTATCCGTGCGCAACGGAGGAATTCTCGT | 40 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0803 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC12 | ACGAGAATTCCTCCGTTGCGGCCCACGGATACAGGATCCTGCATGCCTGTCCACGGATACCGGATCCTCA | 70 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0804 | 27091327 | 2016 | Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr-activated sepharose-4B affinity chromatography | HedC17 | TGCAGGATCCGGTATCCGTGCCAAACACACCAAAAGCCCCCCCAACCCACAACCACGTCC | 60 | 5'-TGCAGGATCCGGTATCCGTG-N40-CGCAACGGAGGAATTCTCGT-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Identify aptamers that bind to and detect SEB in infected serum samples. | N/A | 12 | Enzyme-Linked Immunosorbent Assay (ELISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0811 | 27404735 | 2016 | Highly sensitive detection of lipopolysaccharides using an aptasensor based on hybridization chain reaction | Detection probe | GTCGAATGCTCTGCCTGGAAGAGTTGTTAGCAGGGA | 36 | N/A | ssDNA | Escherichia Coli (E. Coli) O111:B4 | Lipopolysaccharide (LPS) | Developed an aptasensor assay based on hybridization chain reaction (HCR) to detect LPS. | Display a relatively low detection limit (1.73 ng/mL) with a linear response range of 1–10(5) ng/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0816 | 27063716 | 2016 | Magnetic Nanoparticles-based Aptasensor Using Gold Nanoparticles as Colorimetric Probes for the Detection of Salmonella typhimurium | S. typhimurium aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor for S. typhimurium detection using gold nanoparticles (AuNPs) and magnetic nanoparticles (MNPs). | The assay shows a linear response over a range of 25 to 10(5) cfu/mL, and the detection limit was improved to 10 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Thiolated (for Apt1) and 5'-Biotinylated (for Apt2) | N/A | N/A | N/A | N/A | N/A |
| ABdb_0827 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-1 | AAGGGCTGGCTGGGATGGA-CCCTCCCGAAACGAGCTGTCTCTTAACGGAAGCTAATCTGCC-TCACTCCACGGACCCCACT | 80 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | Display a LOD of 10(3) CFU/mL for S. Enteritidis. | 12 | Isothermal Titration Calorimetry (ITC) | 0.971 ± 0.013 µM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0828 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-2 | AAGGGCTGGCTGGGATGGA-TGTAAGAAGGGAGGAAAGGACCTAAGACCTGCTATATTGCGA-TCACTCCACGGACCCCACT | 80 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | Display a LOD of 10(3) CFU/mL for S. Enteritidis. | 12 | Isothermal Titration Calorimetry (ITC) | 0.309 ± 0.071 µM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0829 | 28646719 | 2017 | DNA aptamer-based colorimetric detection platform for Salmonella Enteritidis | Crn-3 | AAGGGCTGGCTGGGATGGA-GGATGGCATTACCTATGCGGTAGATTGCCGACGACCACGAC-TCACTCCACGGACCCCACT | 79 | 5'-AAGGGCTGGCTGGGATGGA-N42-TCACTCCACGGACCCCACT-3' | ssDNA | Salmonella Enteritidis (S. Enteritidis) | Whole cell | Identify aptamers that bind to and develop a sandwich aptamer-based colorimetric bioassay to detect S. Enteritidis at 4°C. | N/A | 12 | Isothermal Titration Calorimetry (ITC) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0898 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-4 | ATACCAGCTTATTCAATTCCA-CACATACCAAAAACACAGCACACTTCATCAATTTCACG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | Sandwich complex pair of SS-3 and SS-4 shows a linear dynamic range of 10(3)-10(6) cells/mL, and a limit of detection of 10(3) cells per mL for S. sonnei. | 8 | Surface Plasmon Resonance (SPR) | 15.89 ± 1.77 nM | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_0899 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-1 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACCTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0900 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-2 | ATACCAGCTTATTCAATTCCA-CCCCATGTCTGTTTCTTTTAACAGGTAATCCGCCTTATGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0901 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-5 | ATACCAGCTTATTCAATTCCA-CAGGACAAAAATTCGGGAAGGCGGCCTTCCACTCTTTCTG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0902 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-6 | ATACCAGCTTATTCAATTCCA-ATACAGTGAAGGCCCAGGAGGCAAATTCTAGGACGAAAGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0903 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-7 | ATACCAGCTTATTCAATTCCA-CACCAAGTCGCCTCCTCTGCCCCCATGTAAATCGTTACAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0904 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-8 | ATACCAGCTTATTCAATTCCA-GAACAATTTCACGCACACCGCGTAGATACCACCTCGTGCA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0905 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-9 | ATACCAGCTTATTCAATTCCA-CGACGAACTACACCACAGGCCCTTAACACATCTACTTGTA-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0906 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-10 | ATACCAGCTTATTCAATTCCA-CATGCTAACTGCCATCACCACTATTTATGATTCCATCCAT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0907 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-11 | ATACCAGCTTATTCAATTCCA-CGCAACACAGAAACACCCGTACACAAACAGTTTCAGCCCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0908 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-12 | ATACCAGCTTATTCAATTCCA-TGCGTAGTTCTCTTAACAACCATTCAGCGTATTTTCGTGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0909 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-13 | ATACCAGCTTATTCAATTCCA-CAGGCACGAGTTCATCACACACCATACACAGTTCGTTACT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0910 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-14 | ATACCAGCTTATTCAATTCCA-CCACACCACACACTACACGCATAAAACCACGAAACTACAC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0911 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-15 | ATACCAGCTTATTCAATTCCA-GGGTATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0912 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-16 | ATACCAGCTTATTCAATTCCA-CATACAGTGGCCAGATTTACCAACACACCTTTCCATACGC-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0913 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-17 | ATACCAGCTTATTCAATTCCA-CCACTCACATATTAACAACACCACATGAATATATTTCG-AGATTGCACTTACTATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0914 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-18 | ATACCAGCTTATTCAATTCCA-ACAGGGCATGTCTTCATCAACGCTTACCACACACCGCTCG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0915 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-19 | ATACCAGCTTATTCAATTCCA-CACTCATGCGCACCGCGTCGCACTTAATCAGTGTTGTGC-AGATTGCACTTACTATCT | 78 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0916 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-20 | ATACCAGCTTATTCAATTCCA-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0917 | 28513559 | 2017 | Detecting and Discriminating Shigella sonnei Using an Aptamer-Based Fluorescent Biosensor Platform | SS-21 | ATACCAGCTTATTCAATTCCA-CAGACACACCAACGCACGGGCACACGCTACAAATGTAAGT-AGATTGCACTTACTATCT | 79 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Shigella Sonnei (KCTC 2518) | Whole cell | Identify and develop an aptamer-based fluorescent biosensor assay to detect and discriminate S. sonnei cells. | N/A | 8 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0932 | 27696554 | 2017 | Evaluation of Staphylococcus aureus DNA aptamer by enzyme-linked aptamer assay and isothermal titration calorimetry | SA31 | TCCCACGATCTCATTAGTCTGTGGATAAGCGTGGGACGTCTATGA | 45 | N/A | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | ELAA and ITC to study impact of temperature and ion concentration in the binding of aptamer to its target on surface of bacteria. | Both temperature and salt concentration directly influenced the 3D structure of the DNA molecule under specified experimental conditions, thereby altering the aptamer's affinity for its target. | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0947 | 28551117 | 2017 | Electrochemical determination of M. tuberculosis antigen based on Poly(3,4-ethylenedioxythiophene) and functionalized carbon nanotubes hybrid platform | MPT64 aptamer | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Developed an electrochemical aptasensor based on MWCNT-doped PEDOT nano-composite for the detection of Mycobacterium tuberculosis. | Exhibits a LOD of 0.5 fg/mL within 15 min for the detection of M. tb antigenic protein with recovery in between (88–95)%. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The stability of the aptasensor is 27 days at 4°C, and the reusability is 7 times after repeated regeneration with 50 mM NaOH. | N/A | N/A | N/A |
| ABdb_0955 | 29071202 | 2017 | An Electrochemical Aptasensor Using Coaxial Capillary with Magnetic Nanoparticle, Urease Catalysis and PCB Electrode for Rapid and Sensitive Detection of Escherichia coli O157:H7 | E. coli aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Develop an electrochemical aptasensor for rapid and sensitive detection of E. coli O157:H7 that relies on aptamer and urease-modified GNPs. | Able to detect E. coli as low as 10(1) CFU/mL in 3 h, and the mean recovery of E. coli in the spiked pasteurized milk was ~99%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0972 | 28910678 | 2017 | Colorimetric aptasensor for the detection of Salmonella enterica serovar typhimurium using ZnFe2O4-reduced graphene oxide nanostructures as an effective peroxidase mimetics | Apt 1 (Capture) | AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | The colorimetric aptasensor platform was developed based on ZnFe2O4/rGO nanostructures, which act as an artificial enzyme (mimetic) that catalyses the oxidation of TMB by H2O2 to detect S. typhimurium. | The limit of detection (LOD) of 11 cfu/mL, and the detection range was 11 to 1.10 × 10(5) cfu/mL of S. typhimurium in buffer solution. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_0979 | https://doi.org/10.1007/s00604-017-2174-7 | 2017 | Aptamer based voltammetric biosensor for the detection of Mycobacterium tuberculosis antigen MPT64 | Aptamer 3 | GTACAAACGACGGCCAGT-CCTTGGGATGATTCAAGCAAAGCCTCACGCCTACGGCTAA-GTCATAGCTGTCTCTCCTG | 77 | 5'-GTACAAACGACGGCCAGT-N40-GTCATAGCTGTCTCTCCTG-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | MPT64 protein | Develop an aptaelectrode based on graphene modified iron-oxide chitosan hybrid (CHIT-IO-GR) nanocomposite film deposited on fluorine tin oxide (FTO) for the detection of the M. tb. specific antigen MPT64. | Exhibited a limit of detection (LOD) of 0.9 fg/mL within 20 min and a linear range from 1.0 × 10(5) fg/mL to 1.0 fg/mL. | 10 | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | The biosensor retained about 80% of its initial activity after 10 uses and good stability of 17 day. | Best Candidate | N/A | N/A |
| ABdb_1003 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 | GTCTTGACTAGTTACGCC-GGGAACAATATGTTCAAGGGCTCTTTAAAGTTTTAGTTCGTTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | LOD was 32 ng for H63. | 8 | Isothermal Titration Calorimetry (ITC) | 3.71 x 10-7 ± 2.12 x 10-11 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1004 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | Exhibited 2.5-fold higher binding with respect to the parent H63, and H63 SL-2 M6 has an LOD of 16 ng. | 8 | Isothermal Titration Calorimetry (ITC) | 9 x 10-8 ± 2 x 10-14 M | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611001550 |
| ABdb_1005 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H33 | GTCTTGACTAGTTACGCC-ACACTAGAAGGTATTTACTATTCTGTGTTAACATGTACTAGCCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1006 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H66 | GTCTTGACTAGTTACGCC-AAGTTTTAATACAACTCACATTAGGGAAAGCTTGCATCCAGGCC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1007 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H70 | GTCTTGACTAGTTACGCC-CAGGACAGGTTAAAATTTTTCTGGATCCCTTTTCATTCTCCATGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1008 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H3 | GTCTTGACTAGTTACGCC-CATACACGGTTACACGTACTGGATAATGTTGATTATGCTTCTGC-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1009 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H18 | GTCTTGACTAGTTACGCC-TAGAACCAAACCTTGTGTAGAAGGGCTTCTCCCGTGTGCTTTGA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1010 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H47 | GTCTTGACTAGTTACGCC-GGATGAACTGTTCCGCTGTGTATCACGCCAAAAGTCCTTATTTG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1011 | 30205966 | 2018 | Generation and application of DNA aptamers against HspX for accurate diagnosis of tuberculous meningitis | H48 | GTCTTGACTAGTTACGCC-CATGAAACCATCTGGTCCGCAATGGGCGCTTGGAATATTCGTCA-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Identify an aptamer that binds to HspX and develop an assay to diagnose TBM in CSF samples. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Diagnostic | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1012 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB10 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 46 ± 24 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1013 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB20 | TAGCTCACTCATTAGGCAC-GCGTTACGTTAGTGGCCGCCTATGAGGACAGGCGGTTGTA-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 128 ± 45 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1014 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB28 | TAGCTCACTCATTAGGCAC-TGGACGTCGTGGCGGAGGTTTTATAAAACGGCGCCACTGT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 49 ± 39 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1015 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB35 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCGCGATTT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | A dual-labelled sandwich detection system was developed using biotinylated RAB10 and FITC-labelled RAB35, with a limit of detection (LOD) of 10^2 CFU/mL of S. aureus, and showed 2.7-fold more signal than other bacteria. | 10 | Flow Cytometry | 34 ± 5 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1016 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB1 | TAGCTCACTCATTAGGCAC-CGGGTGGGCTCCAATATGAATCGCTTGCCCTGACGCTATCT-GCATAGTTAAGCCAGCC | 77 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 56 ± 87 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1017 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB3 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 37 ± 112 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1018 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB5 | TAGCTCACTCATTAGGCAC-CGTAGTCTAGTGTCGATTAGTTTCCTTGCTATTGCAGACCTTGTGCT-GCATAGTTAAGCCAGCC | 83 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | 58 ± 14 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1019 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB9 | TAGCTCACTCATTAGGCAC-TCGAGAGGGATCTCGGGGCGTGCGATGATTTTGCCTTCAT-GCATAGTTAAGCCAGCC | 76 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1020 | 29132030 | 2018 | Capture and detection of Staphylococcus aureus with dual labeled aptamers to cell surface components | RAB21 | TAGCTCACTCATTAGGCAC-GGGGGGTTGTGCCATTTAAGATGACCGGTTGCCAAGATG-GCATAGTTAAGCCAGCC | 75 | 5'-TAGCTCACTCATTAGGCAC-40N-GCATAGTTAAGCCAGCC-3' | ssDNA | Staphylococcus aureus (S. aureus) (RAB 9001) | Whole cell | Identify aptamers that bind to and develop a dual-labelled sandwich detection system for the detection of S.aureus. | N/A | 10 | Flow Cytometry | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1061 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE40 | TACGACTCACTATAGGGATCC-ACCTATGGCAGATTGAGCCCAAGGGCTGTGCAGC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1062 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE42 | TACGACTCACTATAGGGATCC-CCCCGAGTGAAGAGCAGGACAGCGGGACAGCGTC-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1063 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE43 | TACGACTCACTATAGGGATCC-GTGACTGTACGGGCTCAGTCGTTACTTGAGAGTT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | SE43 bound to bacteria was four times higher compared with scrambled control and background controls, and twofold higher in PBS. | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1064 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE48 | TACGACTCACTATAGGGATCC-AATGGCACAGCGCCTGGAACGTACTCTGTACCTG-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1065 | 30477331 | 2018 | Rapid selection of single-stranded DNA aptamers binding Staphylococcus epidermidis in platelet concentrates | SE52 | TACGACTCACTATAGGGATCC-TTCGCATCCGGCACGATGGCTAGGACACCCCGAT-GAATTCCCTTTAGTGAGGGTT | 76 | 5'-TACGACTCACTATAGGGATCC-N34-GAATTCCCTTTAGTGAGGGTT-3' | ssDNA | Staphylococcus Epidermidis (ATCC 49134) | Whole cell | Identify aptamers that capture, detect or remove S. epidermidis contaminant from platelet concentrates. | N/A | 1 | Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | Whole Cell RIDA | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1067 | 29242148 | 2018 | Whole-bacterium SELEX of DNA aptamers for rapid detection of E.coli O157:H7 using a QCM sensor | S1 | CAGTCCAGGACAGATTCGCGAG-TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC-CACGTGGATTTCATTCAGCGATT | 90 | 5'-CAGTCCAGGACAGATTCGCGAG-N45-CACGTGGATTTCATTCAGCGATT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Identify aptamers specifically bound to Escherichia coli O157:H7 and develop a QCM-based aptasensor for its detection. | The limit of detection (LOD) was 1.46 × 10^3 CFU/mL, with a total detection time of 50 minutes. | 19 | Quartz Crystal Microbalance (QCM) | 10.30 nM | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1071 | 29766180 | 2018 | A nitrocellulose membrane-based integrated microfluidic system for bacterial detection utilizing magnetic-composite membrane microdevices and bacteria-specific aptamers | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii | Whole cell | A nitrocellulose membrane-based integrated microfluidic system for detecting bacteria. | Display a limit of detection as low as 450 CFU/reaction for AB within 40 minutes and a linear range from 4.5×10(4) to 4.5 CFU/reaction. | N/A | N/A | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1085 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1 | GTCTTGACTAGTTACGCC-TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1086 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2 | GTCTTGACTAGTTACGCC-TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1087 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4 | GTCTTGACTAGTTACGCC-TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG-TCATTCAGTTGGCGCCTC | 81 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1088 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13 | GTCTTGACTAGTTACGCC-TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | Displayed the highest binding to HupB (≥5 fold relative to RDL). | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1089 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-1T | TAGGAAGGGAAGGAAGATAGAGAGTAGGTCGTCGGAGGCAGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1090 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-2T | TAGTAAAGGGGGTAAGAATCAATTGCGAGGTGGAGTGGGAGTGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | N/A | 8 | Isothermal Titration Calorimetry (ITC) | N/A | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | Patent application no. 20171100124 |
| ABdb_1091 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-4T | TAGGTGATTGCTGGAGTGGGTAGCAGATGGGGGGGGGGTTCTTGG | 45 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-4T treated bacteria yielded reduced intracellular CFU by ∼57.8%. | 8 | Isothermal Titration Calorimetry (ITC) | 1.72 ± 0.00002 μM, | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1092 | 30245472 | 2018 | G-Quadruplex-Forming DNA Aptamers Inhibit the DNA-Binding Function of HupB and Mycobacterium tuberculosis Entry into Host Cells | HupB-13T | TTTGGGAAGGGGGGGGAGGAAGTTCGATGGTGTTGTGGACCGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N3-41X-TCATTCAGTTGGCGCCTC-3' (*N = 3nt sequence tag and **X = 41nt random region) | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | Histone-like protein HupB (Rv2986c) | Identify aptamers that recognise and inhibit the DNA-binding activity of HupB, and significantly block Mtb entry into THP-1 monocytic cells. | HupB-13T treated bacteria yielded reduced intracellular CFU by ∼45.5%. | 8 | Isothermal Titration Calorimetry (ITC) | 0.17 ± 0.00000005 μM | Therapeutics | Subtractive SELEX | 5'-Biotinylated and 5'-FAM Labeled | No loss in the viability of THP-1 cells was observed on exposure to aptamers. | In fetal bovine serum (FBS) for 3 hr at 37°C, no change was observed in the integrity of aptamer bands. | Best Candidate | N/A | Patent application no. 20171100124 |
| ABdb_1095 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-01 | ATACCAGCTTATTCAATT-GGTCGTGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGTG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1096 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-02 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | VFCA-02 and VFCA-03 was linear in the range of 4 × 10(1) to 4 × 10(5) CFU/mL of target cell. | 9 | Surface Plasmon Resonance (SPR) | 1.28 × 10(-10) M | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1097 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-03 | ATACCAGCTTATTCAATT-GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | VFCA-02 and VFCA-03 was linear in the range of 4 × 10(1) to 4 × 10(5) CFU/mL of target cell. | 9 | Surface Plasmon Resonance (SPR) | 1.25 × 10(-9) M | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1098 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-04 | ATACCAGCTTATTCAATT-TGGCATGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1099 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-05 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGGTTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1100 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-06 | ATACCAGCTTATTCAATT-GGGCGTGTGGACTTGCGATTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1101 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-07 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGATTTCGGTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 75 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1102 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-08 | ATACCAGCTTATTCAATT-GGGCATGTGGACTTGCGACTTCGGTTTGGTGTGGTTGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1103 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-09 | ATACCAGCTTATTCAATT-AGACAGCATAGCACTGTAACGATTGGTTTGGTGTGGTTGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1104 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-10 | ATACCAGCTTATTCAATT-CCAGAATTGGTGGGTCGACTGCTGGTGTCCTATAAAGGGG-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1105 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-11 | ATACCAGCTTATTCAATT-CGTGGGCGGTAGAGCCAATGCTACTGGAGCGCGTATCCTA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1106 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-12 | ATACCAGCTTATTCAATT-GTCGGAGAGCCCGGCCGTCTGCTCGTAAGTACTATCATAGC-AGATAGTAAGTGCAATCT | 77 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1107 | 29553704 | 2018 | Aptamer-Based Paper Strip Sensor for Detecting Vibrio fischeri | VFCA-13 | ATACCAGCTTATTCAATT-GCGGACGGATAGTAAATAGCCCATGTACGCTGCTGGCGTC-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Fischeri (ATCC 49387) | Whole cell | Identify aptamers against Vibrio fischeri and develop an aptamer-based paper strip sensor for its detection. | N/A | 9 | Surface Plasmon Resonance (SPR) | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1126 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S1 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGCTGGTGGCCATTGGCTCGTGTCTCGTTACTGCCGAGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | Exhibited a linear concentration ranging from 2×10(1) to 2×10(5) CFU/mL and LOD of 20 CFU/mL. | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1127 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S2 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGAATGACCTGGATTGACCCGTGAGTGTAGCATTTGTCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1128 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S3 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TTGACGATACGCAGGGGCGATACAGACAGTCTGCGTATTC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1129 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S4 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGTATCCCTCCTCGCTTCCATACCCAAACCGGACACACC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1130 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S5 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGCATGCACCTCACGCATCGAGCACTCACTCCTTCTACG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1131 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S6 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCTCCCGAGGACACACACACACCATCGCGGTACTCTCCCG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1132 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S7 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GCGCACCTCCGCCCTGTCGGGCGTCGTTTCCCCACGAATC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1133 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S8 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTTTCCGTATGCGCAGCGCCATACACCTGTCTGATCTCCCC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1134 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S9 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTCGCAAGGACTCGATCTGGTGGTACCTGCTTTCCGTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1135 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S10 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGAGCACCAAGGATAGTTAGCGGTCGCCTTCACACTAGGC-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1136 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S11 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTGACAGATTAAAAGTGGTTGGGCAACTTCTGCTTGCGAA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | 4.41 × 10(-12) M | Detection | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1137 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S12 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GGTGGTGTTGACAATTGAACCTTTGCAGGGGTCTGGTGGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1138 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S13 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTGGAGGTGCGCTATAGGTCTCTCCGGGTACTGATCCAAT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1139 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S14 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CCGACCCGTAACGCCAGTGAGGGAACACTCTGGAATAGTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1140 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S15 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGAGCAAACTGATAAACTCCGCCATGTCAGGCAAAGCTTT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1141 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S16 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CTTCGTTCCGTTGACATAATTCAATTTTGCGTATTTCTTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1142 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S17 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-ATGGGGCTAGTCTACTTCTGTGTCTACCTAGGATTCCGCT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1143 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S18 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TGTAGGCGTAACCTCCTACTCTGTGCACTGTCTAAAGTGAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1144 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S19 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CGCGGCGTACGCTATCTTGTAACCTCCCGAACTATAACCAC-AGATAGTAAGTGCAATCT | 101 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1145 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S20 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CAAGCGACTCGACCGTGGTACCTCCCCAATAGCCATTTGA-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1146 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S21 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-TCTCGCAGCCTCTTCCAATCTTGTTATTTACGCTTTCTGT-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1147 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S22 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-CACAAAGGAGCAAGAACTCAATTGCGCTCGTACCTTGTGG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1148 | 30165934 | 2018 | Aptamer-Based Pathogen Monitoring for Salmonella enterica ser. Typhimurium | S23 | GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-GTAGCTGGGGTCCGGATCTGCGGTTCAGTGCGCTATTGTG-AGATAGTAAGTGCAATCT | 100 | 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Salmonella Typhimurium (S. Typhimurium) ( ATCC 19585) | Whole cell | Identify aptamers and develop an aptamer-based sandwich assay to detect S. enterica ser. Typhimurium. | N/A | 10 | Surface Plasmon Resonance (SPR) | N/A | Detection | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1151 | 29777309 | 2018 | Fluorometric determination of Vibrio parahaemolyticus using an F0F1-ATPase-based aptamer and labeled chromatophores | V. parahaemolyticus aptamer | TCTAAAAATGGGCAAAGAAACAGTGACTCGTTGAGATACT | 40 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Developed an F0F1-ATPase-based aptasensor for the fluorometric determination of V. parahaemolyticus. | The relative fluorescence varies linearly over the 15 to 1.5 × 10(6) cfu/mL Vibrio parahaemolyticus concentration range, and the limit of detection is 15 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1152 | 29448635 | 2018 | Surface Plasmon Resonance Aptamer Biosensor for Discriminating Pathogenic Bacteria Vibrio parahaemolyticus | VPCA_Apta#1 | ATACCAGCTTATTCAATT-CCATGGTCCCTCGTGTTTATTATGTTGTCTGAACTGGCTG-AGATTGCACTTACTATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Isolate specific aptamers against Vibrio parahaemolyticus and develop an SPR biosensor for its detection. | VPCAapta#1 was significantly higher (798.41 ng/ul) than that of the other aptamer. | 11 | Surface Plasmon Resonance (SPR) | 2.04 ± 0.12 nM | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1188 | 28887814 | 2018 | Construction and application of an electrochemical biosensor based on an endotoxin aptamer | EAQ2 | ATGAGAGCGTCGGTGTGGTATGCTCACCCCCTGCGGCGCCGTTACGCGGTCCTTGTGTAGGAGGGTGCGGAAGTA | 75 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L2880) | Lipopolysaccharide (LPS) | An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin. | N/A | N/A | Bio-Layer Interferometry (BLI) | 32.5 nM | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1189 | 28887814 | 2018 | Construction and application of an electrochemical biosensor based on an endotoxin aptamer | EAQ3 | ATGAGAGCGTCGGTGTGGTATCGCCGCGCTCGCCGATCGTTCCTCCCCCCCCGTCTGTAGGAGGGTGCGGAAGTA | 75 | N/A | ssDNA | Escherichia Coli (E. Coli) 055:B5 (L2880) | Lipopolysaccharide (LPS) | An electrochemical aptasensor was developed using an aptamer assembled on a gold electrode surface using 3-mercaptopropionic acid (MPA) as an intermediate linker to detect endotoxin. | Showed a low detection limit of 0.001 EU/mL and a linear range of 0.001–1 EU/mL. | N/A | Bio-Layer Interferometry (BLI) | 22.9 nM | Biosensor | N/A | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | The biosensor maintained a steady EIS response value after 1 week of storage in the PBS (10 mM, pH 7.4) at 4°C, and the response value still occupied 90%. | Best Candidate | N/A | N/A |
| ABdb_1201 | 30001487 | 2018 | Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens | E. coli aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (CICC 21530) | Whole cell | Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens. | The detection limits were 100 cfu/mL in milk, 80 cfu/mL in human serum, and 80 cfu/mL in human urine for E. coli. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3'-Cyanine3 (Cy3) Labeled | Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h. | N/A | N/A | N/A | N/A |
| ABdb_1202 | 30001487 | 2018 | Magnetism-Resolved Separation and Fluorescence Quantification for Near-Simultaneous Detection of Multiple Pathogens | S. typ aptamer | ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT | 87 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Aptamer-modified fluorescent-magnetic multifunctional nanoprobes (apt-FMNPs) for near-simultaneous detection of multiple pathogens. | The detection limits of 150 cfu/mL in milk, 120 cfu/mL in human serum, and 120 cfu/mL in human urine for S. typ. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 3'-FAM Labeled | Bacterial viability remained about 100% during incubation with apt-FMNPs nanoprobes at successive incubation time points of 0, 0.5, 1, 3, 6, 12, and 18 h. | N/A | N/A | N/A | N/A |
| ABdb_1214 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10-Trunc | GGTGGTGGTGG | 11 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibited MS activity with an IC₅₀ of 251.1 nM; Ki of 230 nM; inhibited M. tb invasion into human THP-1 monocytic cells. | 10 | Surface Plasmon Resonance (SPR) | 1.9 × 10−11 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | Indian Patent application no. 201611021901 |
| ABdb_1215 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS4 | GGACCAGGTGAGTGGATGCGGGTGCGGGTGGGGGTGAGGGGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.9 × 10−9 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1216 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS5 | GCAGAGAGAGAGAAAGTGAGAAGGGCGGGGGGGAGAGGGTGGGG | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.7 × 10−6 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1217 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS6 | GGTGGGATGGGGGGGGGAGGGTAGGGTGTGCAAGTAGAGGGTC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 2.8 × 10−10 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1218 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS10 | GGTGTGTTGACTGAGGGGGTGGGGTGGGTGGTGGTGGATATAGC | 44 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 1.2 × 10−8 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1219 | 31704587 | 2019 | Theranostic Application of a Novel G-Quadruplex-Forming DNA Aptamer Targeting Malate Synthase of Mycobacterium tuberculosis | MS20 | GGGTTGTAAGAGGGAGCTGGGAGGGGTCGGGGGGGGGGGTGGC | 43 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (H37Rv) | Surface-associated Malate synthase (MS -Whole cells) | Identify aptamers that bind to and inhibit the MS enzyme activity, thereby blocking bacterial entry into host cells. | Inhibition of MS activity, the aptamers were ranked as MS10 (IC50 of 275.6 nM, Ki of 270 nM) > MS5 > MS20 > MS4 > MS6. | 10 | Surface Plasmon Resonance (SPR) | 9.1 × 10−7 M | Therapeutics | SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1225 | 31216306 | 2019 | Aptamer-based fluorometric determination of Salmonella Typhimurium using Fe3O4 magnetic separation and CdTe quantum dots | Aptamer (ssDNA1) | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Outer membrane protein (OMP) | Develop an aptamer-based (Apt-MNPs) fluorescence assay for the determination of Salmonella Typhimurium. | Exhibit a linear range of 10 to 10(10) cfu/mL with LOD of 1 cfu/mL within 2 h, and is successfully applied to the analysis of spiked food samples with good recoveries from 90% to 105%. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1227 | 30877887 | 2019 | A new aptamer/polyadenylated DNA interdigitated gold electrode piezoelectric sensor for rapid detection of Pseudomonas aeruginosa | P. aeruginosa aptamer | CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCTTCCTTTCTTG | 60 | N/A | ssDNA | Pseudomonas Aeruginosa (ATCC 27853) | Whole cell | Developed a piezoelectric sensor (Au IDE-MSPQC) based on magnetic bead/aptamer/polyadenylated-DNA for the detection of P. aeruginosa. | The limits of detection (LOD) of the method were as low as 9 CFU/mL in buffer and 52 CFU/mL in a simulated blood sample. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1262 | 30721047 | 2019 | Colorimetric Aptasensor Based on Truncated Aptamer and Trivalent DNAzyme for Vibrio parahemolyticus Determination | A4 | CAACGAAACAGTGACTCGTTG | 21 | N/A | ssDNA | Vibrio Parahaemolyticus (ATCC 17802) | Whole cell | Identify an aptamer against and develop a colorimetric aptasensor based on magnetic nanoparticles (MNPs) and G4 DNAzyme to detect V. parahemolyticus in contaminated salmon samples. | N/A | N/A | Flow Cytometry | 28.65 ± 3.05 nM | Biosensor | Whole Cell-SELEX | 5'-FAM Labeled and 5'-Biotinylated (Biotin-TTTTTTTTT) | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1276 | 30352198 | 2019 | A novel aptamer-based test for the rapid and accurate diagnosis of pleural tuberculosis | H63 SL-2 M6 | AGGGCTTTTTTTTTTTTTAGTTCGTTTG | 28 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | HspX antigen | Aptamer-Linked Immobilized Sorbent Assay (ALISA) was developed to detect pleural TB (pTB). | Detects pTB with ~93% sensitivity and ~98% specificity. | N/A | N/A | N/A | Diagnostic | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | Indian Patent application no. 201611001550 |
| ABdb_1281 | 31718045 | 2019 | Aptamer Affinity-Bead Mediated Capture and Displacement of Gram-Negative Bacteria Using Acoustophoresis | GN6 aptamer | ATACCAGCTTATTCAATTGGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGAAGATAGTAAGTGCAATCT | 76 | N/A | ssDNA | Gram-negative Bacteria | Whole cell | Develop aptamer-modified microbeads and an acoustophoresis method for capturing and displacing gram-negative bacteria. | It achieved high recovery (up to 98%) and high purity (up to 99.5%). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1282 | 31511614 | 2019 | Detection of Gram-negative bacterial outer membrane vesicles using DNA aptamers | GN6 | ATACCAGCTTATTCAATT-GGGTGAGGGGGGGTTCACAACGTTAAAGATAGACGGGGGA-AGATAGTAAGTGCAATCT | 76 | 5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3' | ssDNA | Gram-negative Bacteria (Escherichia Coli (E. Coli) DH5α, Escherichia Coli (E. Coli) K12, and Serratia Marcescens) | Whole cell | Isolated aptamers against multiple Gram-negative bacterial species and developed an aptamer-based detection tool (ELAA) towards bacterial secretory cargo released from the outer membranes of Gram-negative bacteria. | Can detect as low as 25 ng/mL of bacterial OMVs, and dissociation constants of GN6 to OMVs derived from E. coli DH5α, E. coli K12 and S. marcescens were 0.13 ± 0.01 μg/ml, 3.70 ± 0.98 μg/ml and 0.23 ± 0.16 μg/ml, respectively. | 12 | Fluorescence Binding Assay | 29.94 ± 2.49 nM (for E. coli DH5α), 59.70 ± 10.89 nM (for E. coli K12) and 38.98 ± 6.46 nM (for S. marcescens) | Detection | Sequential Toggle Cell-SELEX (STC-SELEX) | 5'-Biotinylated and 3'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1285 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA2 | GACGCTTACTCAGGTGTGACTCG-TCGGTCGGGTGGTTGGGGCGGGTGGTCGGTTTTTAAGTTGTGTCATTGTC-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA2 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity. | 9 | Flow Cytometry | 14.31 ± 4.26 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1291 | 30859598 | 2019 | Selection and characterization of ssDNA aptamers specifically recognizing pathogenic Vibrio alginolyticus | VA8 | GACGCTTACTCAGGTGTGACTCG-CGTTTTATTGGTGTGGGGCTGGGGTGGTGGGTGGCTCTACTGGTTCCGTT-CGAAGGACGCAGATGAAGTCTC | 95 | 5'-GACGCTTACTCAGGTGTGACTCG-50N-CGAAGGACGCAGATGAAGTCTC-3' | ssDNA | Vibrio Alginolyticus | Whole cell | Identify aptamers targeted against viable V. alginolyticus. | VA8 could recognize different V. alginolyticus prevalent in Beibu Gulf with high specificity and affinity but less potent than VA2. | 9 | Flow Cytometry | 90.00 ± 13.51 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | No cytotoxic effects shown in vitro and in vivo. | N/A | Best Candidate | N/A | N/A |
| ABdb_1328 | https://doi.org/10.3390/app9020295 | 2019 | Development of an Electrochemical Biosensor for Rapid and Effective Detection of Pathogenic Escherichia coli in Licorice Extract | Aptamer (Seq.1) | CAGCTCAGAAGCTTGATCCTACCAGTAGACTTTCAACTTTACTGCCATCGTGTGCCCTAAGACTCGAAGTCGTGCATCTG | 80 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 10372) | Whole cell | Developed an aptamer-based electrochemical biosensor for the rapid detection of E. coli in liquorice extract. | Concentrations ranging from 5.0 × 10^2 CFU/mL to 5.0 × 10^7 CFU/mL exhibited a linear trend, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1341 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | A1 | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Acinetobacter Baumannii | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(3) for AB. | 3 | Fluorescence Spectroscopy | 6.8 ± 1.9 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1342 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | E27 | ACAGCACCACAGACCACAGATCATACCAGTGCGGCCGTTAGCCTCGTTAATCTGGCGTTTGTCTTCCTGCC | 71 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Escherichia Coli (E. Coli) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(4) for EC. | 3 | Fluorescence Spectroscopy | 11.9 ± 3.7 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1343 | https://doi.org/10.1016/j.snb.2018.12.112 | 2019 | Screening of highly-specific aptamers and their applications in paper-based microfluidic chips for rapid diagnosis of multiple bacteria | O28 | GGGGAAGACAAACACCTCATAGTCGGTATCGGCCGTTTGGGCGTTTTTCCGATGGTCTGTGGTGCTGT | 68 | 5'-GGCAGGAAGACAAACA-N40-TGGTCTGTGGTGCTGT-3' | ssDNA | Methicillin-resistant Staphylococcus aureus (MRSA) | Whole cell | Identify aptamers and develop a dual-aptamer, NC-based microfluidic chip for fast diagnosis of three common nosocomial bacteria. | LOD was estimated to be 10(5) CFU/μL for MRSA. | 3 | Fluorescence Spectroscopy | 199.6 ± 35.8 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1348 | 31318203 | 2019 | Engineering DNA-Nanozyme Interfaces for Rapid Detection of Dental Bacteria | S. mutans-binding aptamer | ATACTATCGCATTCCTTCCGAGGGGGGAGGGGGGGGTGGGGGTCGGT | 47 | N/A | ssDNA | Streptococcus Mutans (ATCC 25175) | Whole cell | Developed a DNA-engineered nanozyme interface using aptamers for the detection of dental bacteria. | The detection limit is 12 CFU/mL, and the linear range is 0 to 10(9) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1403 | 32037808 | 2020 | Gold Nanobones Enhanced Ultrasensitive Surface-Enhanced Raman Scattering Aptasensor for Detecting Escherichia coli O157:H7 | Apt-2 | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 42 | N/A | ssDNA | Escherichia Coli (E. Coli) O157:H7 (ATCC 43888) | Whole cell | Developed a one-pot step method based on capture probe (MNPs + Apt-2) and the signal probe (GNR(Apt‑1+RhB)) for SERS detection of E. coli O157:H7. | Exhibited a linear range of 10-10,000 cfu/mL with a limit of detection of 3 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1404 | 32685985 | 2020 | Electrochemical aptasensor using boron-carbon nanorods decorated by nickel nanoparticles for detection of E. coli O157:H7 | Anti-E. coli O157:H7 aptamer | ATCCAGAGTGACGCAGCA-GGGTGGCGAGACTGGGCGGGTGTCGGGAAGTGAACCGGTGGCGTG-TGGACACGGTGGCTTAGT | 81 | 5'-ATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3' | ssDNA | Escherichia Coli (E. Coli) O157:H7 | Whole cell | Developed a label-free impedimetric aptasensor for the detection of E. coli O157:H7 employing boron-carbon nanorods decorated by nickel nanoparticles (BC-Ni) nanostructured platform. | Detect E. coli O157:H7 selectively with a detection limit of 10 cfu and a dynamic detection range of 10(0) to 10(5) cfu in water, juice, and faecal samples. | 15 | Bio-Layer Interferometry (BLI) | 69.73 nM | Biosensor | Microtiter Plate-based Cell SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1413 | https://doi.org/10.3390/IECB2020-07079 | 2020 | Detection of Listeria innocua by Acoustic Aptasensor | Aptamer | TACTATCGCGGAGACAGCGCGGGAGGCACCGGGGA | 35 | N/A | ssDNA | Listeria Innocua | Whole cell | QCM-based aptasensor for the detection of pathogenic bacteria Listeria innocua. | The achieved limit of detection was approximately 1.6 × 10(3) CFU/mL and broad range of 5 × 10(3)-10(6) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1436 | 32350613 | 2020 | A fluorescent aptasensor for Staphylococcus aureus based on strand displacement amplification and self-assembled DNA hexagonal structure | Aptamer | CACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 48 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | A fluorescent aptasensor based on MB-apt-cDNA duplex for S. aureus in milk samples. | Exhibits a broad linear range from 7 to 7 × 10(7) CFU/mL, with a detection limit of 1.7 CFU/mL for S. aureus. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1438 | 32070611 | 2020 | Rapid and sensitive detection of Salmonella Typhimurium using nickel nanowire bridge for electrochemical impedance amplification | Aptamer | CAGTCCAGGACAGATTCGCGAGCCCACTCCAAACACGACCAACTCACGCTCTATCAACATCGCTATCCACGTGGATTTCATTCAGCGATT | 90 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an electrochemical aptasensor using an aptamer-coated gold interdigitated microelectrode and antibody-modified NiNWs to detect Salmonella typhimurium. | This electrochemical aptasensor quantitatively detected Salmonella at concentrations ranging from 10(2) to 10(6) CFU/mL within 2 h, with a detection limit of 80 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1441 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A15-1 | GTGGGGTTGAAAACGCCGGAGAGGGTGTGTGGGTGGGGTA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A15-1 could bind to M. hyorhinis, and mixed mycoplasma-infected cells were detectable within 30 min. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1442 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | A16-1Y | TGGGTGGGGTTGTCGCTAGGGGTTTAAGGGGTCGTCGTGA | 40 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | A16-1Y could bind to M. hyorhinis and mixed mycoplasma-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1443 | 32471128 | 2020 | Aptamer Cocktail to Detect Multiple Species of Mycoplasma in Cell Culture | #1J | ATCCAGAGTGACGCAGCAGCCAACGTGCTTTCTACCTTATTTTCCGTCACTCTCACTCTGGACACGGTGGCTTAGT | 76 | N/A | ssDNA | Mycoplasma Hyorhinis | Mycoplasma hyorhinis-infected cells | Develop an aptamer cocktail for detecting multiple species of mycoplasma in infected cell lines. | #1J could bind to unclassified mycoplasma-infected cells, but not M. hyorhinis-infected cells. | N/A | Flow Cytometry | N/A | Detection | N/A | 5'-Biotinylated and Cyanine3 (Cy3) Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1462 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA1 | CTGCGATCAAGTTACGCACCTCGCCATGTTCCCCGCCCGGCATGTGTTATGCCCCTGTG | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | C. jejuni can be detected from 1.7 × 10(1) to 1.7 × 10(6) CFU/mL. The limit of detection (LOD) is obtained as 10 CFU/mL in PBS and 13 CFU/mL in contaminated milk samples. | 12 | Fluorescence Binding Assay | 1.37 ± 0.28 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1463 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA2 | GTTGGGTGCGGCGGGAGGGTCCCATCGGAAACCAAGCTGTGCTGAGATTTTTCCGCGAT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 1.78 ± 0.88 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1464 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA3 | CACGCAAGTTAATCAGCGTGACATCAGGTCTAGATTCCGGCTTATAGCGCCAGGTTTCC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.01 ± 0.90 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1465 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA4 | GGTGGGCTCTGTTCGGGAGGGGTATTGTTAGGACCGAGAGGCTGCATTCCGCCAGCTGC | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 2.26 ± 0.91 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1466 | 32663006 | 2020 | Selection of Specific DNA Aptamers for Hetero-Sandwich-Based Colorimetric Determination of Campylobacter jejuni in Food | CJA5 | GCTCTGTCTTTTCAGCTTTATCCGGGTGTGGTGGGGGGGGGATTTGCTTGGTCGGTTCT | 59 | 5'-AGCAGCACAGAGGTCAGATG-N59-TTCACGGTAGCACGCATAGG-3' | ssDNA | Campylobacter Jejuni | Whole cell | Identify aptamers and develop a hetero-sandwich-based assay for colorimetric analysis of C. jejuni from contaminated samples. | N/A | 12 | Fluorescence Binding Assay | 3.53 ± 1.38 nM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1467 | 32980107 | 2020 | A novel method combining aptamer-Ag10NPs based microfluidic biochip with bright field imaging for detection of KPC-2-expressing bacteria | XK10 | GGCAGGACACCGTAACGGGTATGCAGCTATCCCGGGCGCTGTCTGAAGATCGTGTGCTGCT | 61 | N/A | ssDNA | Escherichia Coli expressing KPC-2 (KPC-2 E. Coli) | Klebsiella Pneumoniae Carbapenemase 2 (KPC-2) serine β-lactamase | Developed a PDMS/glass microfluidic biochip integrated with aptamer-modified Ag(10)NPs nano-biosensors to detect whether bacteria express KPC-2. | Detects the target bacterium with a detection limit of 10(2) CFU and a capture efficiency exceeding 90% in ∼1 h. | 8 | Surface Plasmon Resonance (SPR) | 0.81 nM | Biosensor | Protein SELEX and Whole Cell-SELEX | 5'-Biotinylated and 5′-Thiolated (SH-AAAAA) and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1495 | 32994896 | 2020 | Aptamer-nanobody based ELASA for detection of Vibrio cholerae O2 | V.ch47 | GCCTGTTGTGAGCCTCCTAAC-CGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTC-CATGCTTATTCTTGTCTCC | 79 | 5'-GCCTGTTGTGAGCCTCCTAAC-N38-CATGCTTATTCTTGTCTCC-3' | ssDNA | Vibrio Cholerae O1 [Inaba (ATCC 39315) and Ogawa] | Whole cell | Identify aptamers and develop aptamer-nanobody-based ELISA for V. cholerae O1 detection. | Identify 10(4) CFU/ml with 25 pM of biotinylated aptamer and only 20 μg/ml of VHH without any cross-reactivity. | 12 | Flow Cytometry | 15.404 ± 4.776 pM | Detection | Whole Cell-SELEX | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1497 | https://doi.org/10.1016/j.foodcont.2020.107281 | 2020 | A novel AuNPs colorimetric sensor for sensitively detecting viable Salmonella typhimurium based on dual aptamers | Apt1 | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric aptasensor based on AuNPs for visual detection of viable S. typhimurium. | Showed a linear range from 3.3 × 10(1) to 3.3 × 10(6) CFU/mL and the detection limit of 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1542 | 34828820 | 2021 | A Colorimetric Strategy Based on Aptamer-Catalyzed Hairpin Assembly for the On-Site Detection of Salmonella typhimurium in Milk | Capture aptamer (Bapt) | GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colourimetric assay based on aptamer-catalysed hairpin assembly signal amplification strategy (Y-CHA ) for the detection of S. typhimurium in milk. | Exhibited a concentration range of 10(2) to 10(6) CFU/mL, with a sensitivity of 2.4 × 10(2) CFU/mL under optimal conditions and 2.8 × 10(3) CFU/mL in real milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1546 | 34660993 | 2021 | Detection of Listeria monocytogenes Using Luminol-Functionalized AuNF-Labeled Aptamer Recognition and Magnetic Separation | Aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19115) | Whole cell | Developed an aptamer-linked biofunctional magnetic nanomaterial system for highly sensitive and specific LM detection. | Display a linear concentration range 1.0 × 10(1)-1.0 × 10(5) CFU/mL and detect L. monocytogenes at levels as low as 6 CFU/mL in milk samples. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1568 | 33421762 | 2021 | Controllable design of a nano-bio aptasensing interface based on tetrahedral framework nucleic acids in an integrated microfluidic platform | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) O157: H7 (ATCC 43889) | Whole cell | Developed a tetrahedral framework nucleic acids-based aptasensing interface in the microfluidic system for E. coli O157: H7 detection and antimicrobial susceptibility testing (AST) determination. | A calibration curve was constructed over 10(1) to 10(5) CFU/mL, with a limit of detection of 10(1) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-CGGAATTCCG) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1588 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | S. aureus-aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for S. aureus was 3 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1589 | 34753577 | 2021 | An efficient SERS platform for the ultrasensitive detection of Staphylococcus aureus and Listeria monocytogenes via wheat germ agglutinin-modified magnetic SERS substrate and streptavidin/aptamer co-functionalized SERS tags | L. mono-aptamer | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 47 | N/A | ssDNA | Listeria Monocytogenes | Whole cell | Developed an aptasensor using WGA modified-Fe3O4@Au MNPs and Streptavidin (SA)/aptamer co-functionalized SERS tags for S. aureus and L. mono detection. | The LOD for L. mono was 5 cells/mL and a favorable linear relation (10-10(7) cells/mL). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (biotin-C6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1593 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 10(2) to 10(7) cfu/mL, with a detection limit of 50 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Cy3 and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1594 | 34041580 | 2021 | Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus | S. aureus aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Whole cell | Developed an aptamer-facilitated gold/silver nanodimer SERS probe for the simultaneous detection of the two bacteria with the help of magnetic separation enrichment. | Achieved a linear range of 3.2 × 10(2) to 3.2 × 10(7) cfu/mL, with a detection limit of 96 cfu/mL. | N/A | N/A | N/A | Biosensor | N/A | 5′-SH-A-Rox and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1654 | 35934342 | 2022 | Sandwich fluorometric method for dual-role recognition of Listeria monocytogenes based on antibiotic-affinity strategy and fluorescence quenching effect | Aptamer | TTTTTTTTTTATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | 57 | N/A | ssDNA | Listeria Monocytogenes (ATCC 19111) | Whole cell | Developed a sandwich fluorimetric method (MNPs-Van) for dual-role recognition of L. monocytogenes. | Achieved a low detection limit (LOD) of 2.8 × 10(2) CFU/mL in 1.5 h with a concentration range over 10(2)-2 × 10(8) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1664 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR22 (APT-1) | GTCTTGACTAGTTACGCC-CTGCTGGTCTTTAGTCTCTATTGAGTGGCTAAAGTTGAGGCAG-TCATTCAGTTGGCGCCTC | 79 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | Identify an aptamer against DevR and inhibit DevR-dependent transcription by blocking DevR dimerisation and DNA-binding activity in Mycobacterium smegmatis. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1665 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR25 (APT-2) | GTCTTGACTAGTTACGCC-CTGCCTTTTCAAAAGTTTATTGGGATGTACTTTTGTTCAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1666 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR28 (APT-3) | GTCTTGACTAGTTACGCC-CATAAACGCAGTGACGTTCCCAGAATTGTGGCTGATGATTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | N/A | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1667 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R6DevR10 (APT-4) | GTCTTGACTAGTTACGCC-GCGAGAATGTGCGCAAAGTCTCATGTCAGTATGTGGTCTTTTCG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-4 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 61% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1668 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR16 (APT-5) | GTCTTGACTAGTTACGCC-CTGCCTTGGCTCGAAGGGGTGATGAGAAGTAGGCGGGAAGGCAG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1669 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR28 (APT-6) | GTCTTGACTAGTTACGCC-CGAGGGGAAGGATGGGGTGGAGGGAGGTGGGGGAGGGTTGGTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-6 inhibited Rv1738 promoter activity in a time-dependent manner, with an inhibition value of 66% at 96 hours and inhibited DevR–DevR interaction in vivo by ∼35%. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | 4.724 nM | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1670 | 36332135 | 2022 | DNA Aptamer Targets Mycobacterium tuberculosis DevR/DosR Response Regulator Function by Inhibiting Its Dimerization and DNA Binding Activity | R7DevR29 (APT-7) | GTCTTGACTAGTTACGCC-CCCAAGAACCCGCTCGCCGTGGTGACGTCGATCATGCCTTTTGG-TCATTCAGTTGGCGCCTC | 80 | 5'-GTCTTGACTAGTTACGCC-N44-TCATTCAGTTGGCGCCTC-3' | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | DevR protein | By targeting DevR dimerization, it blocks the essential step in DevR activation, thus intercepting dormancy pathways in mycobacteria. | APT-1, APT-2, APT-5, and APT-7 exhibited a maximum of ∼40% inhibition of Rv1738 promoter activity. | 8 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Therapeutics | Subtractive Nitrocellulose Membrane (NCM)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1718 | 36058939 | 2022 | Multiple amplification-based fluorometric aptasensor for highly sensitive detection of Staphylococcus aureus | Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a fluorometric aptasensor for the detection of S. aureus using magnetic nanoparticles (MNPs). | The proposed fluorometric aptasensor displays LOD of (1.23 cfu/mL, a wide linear range (1 ~ 10(8) cfu/mL), and a fast detection speed (~ 1.5 h). | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated (Biotin-(CH2)6) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1720 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B46 | GGCGGCGATGAGGATGAC-GAGAGTAAAGGCCATCGGCGGCCATTTATGTTGTACCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | LOD value as low as 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 616 ± 13 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1721 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B48 | GGCGGCGATGAGGATGAC-ACTATTTACGTTGGAACTTAAGTCCCACATGCACTGCC-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1722 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B70 | GGCGGCGATGAGGATGAC-CTATAGTGCTCAAGTGCGATGCCAAGCTGGCACGATAG-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | B70 showed about 35% higher affinity for Brucella cells than the B46 aptamer, and the SPR sensor showed an LOD of 27 ± 11 cells. | 15 | Fluorescence Binding Assay | 632 ± 132 cells/ml | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1723 | 34809985 | 2022 | Surface plasmon resonance aptasensor for Brucella detection in milk | B72 | GGCGGCGATGAGGATGAC-TCCGTGACAAGTGCGATGCCATTCCGCGTGACAGTGAT-ACCACTGCGTGACTGCC | 73 | 5'-GGCGGCGATGAGGATGAC-N38-ACCACTGCGTGACTGCC-3' | ssDNA | Brucella Melitensis | Whole cell | Developed a surface plasmon resonance (SPR) aptasensor for the detection of B. melitensis in milk samples. | N/A | 15 | Fluorescence Binding Assay | N/A | Biosensor | Whole Cell-SELEX | 5'-Amidation (NH₂) and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1739 | https://doi.org/10.1016/j.snb.2021.130933 | 2022 | Introducing an SPRi-based titration assay using aptamers for the detection of Legionella pneumophila | R10C5 | GCAATGGTACGGTACTTCCGGACAGTGCTGAAAACTGTGACCCCCCAAAAGTGCACGCTACTTTGCTAA | 69 | N/A | ssDNA | Legionella Pneumophila (Lp) strain Lp02 | Whole cell | SPRi-based titration assay using Lp aptamer for detecting L. pneumophila. | The limit of detection for this system was 10(4.4) cells/ml, with a linear dynamic range of 10(4.3) –10(7.7) cells/ml. | N/A | N/A | N/A | Biosensor | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent application no US 16/850,355 |
| ABdb_1775 | 37449120 | 2023 | Colorimetric aptasensor for detection of Bacillus cytotoxicus spores in milk and ready-to-use food | BAS-6R | ATCCGTCACACCTGCTCTGCACGGGCTCAGTTTGGCTTTGTATCCTAAGAGGATGGTGTTGGCTCCCGTAT | 71 | N/A | ssDNA | Bacillus Cereus ssp. cytotoxicus (NVH 391-98A) | B. cytotoxicus spores | Develop a colorimetric assay employing AuNPs and magnetic particles (MPs) for the detection of Bacillus cytotoxicus spores in food. | Achieving the naked-eye limit of detection as low as 10(2) cfu/mL in water and milk, and 10(4) cfu/mL in mashed potatoes. | N/A | N/A | N/A | Biosensor | N/A | 5′-Thiolated and 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1778 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T1-280 | ACTGTCrGrCrGrCrArCrGrCrGrUrGrUrGrUrArGrUrArCrArCrArCrGrArUrCrGrCrGrCrGrCrArCrArArUrArU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T1-280 RNA was 113 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 2.2 ± 0.5 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1779 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T2-139040 | ACTGTCrArArUrUrUrGrArArUrArUrArUrUrArGrUrGrCrGrCrGrCrCrGrUrArGrUrGrUrGrUrArArArArArUrU | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T2-139040 RNA was 17 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 1.0 ± 0.3 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1780 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | T3-117558 | ACTGTCrArArUrUrUrGrArGrUrGrUrGrUrGrArUrCrArUrArUrArUrCrGrUrArGrCrGrCrGrCrUrArCrArArCrC | 46 | N/A | ssRNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of T3-117558 RNA was 11 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 0.7 ± 0.4 nM | Detection | In-silico Method | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC), rX = RNA nucleotide | N/A | N/A | N/A | N/A | N/A |
| ABdb_1781 | 37327207 | 2023 | FRET-Based Single-Molecule Detection of Pathogen Protein IsdA Using Computationally Selected Aptamers | A14 | ACTGTCCACACCGCAGCAGTGGGAACGTTTCAGCCATGCAAGCATCACGCCCGT | 54 | N/A | ssDNA | Staphylococcus aureus (S. aureus) | Iron-regulated Surface Determinant Protein A (IsdA) | Develop a FRET-based aptasensor for single-molecule detection of IsdA. | LOD value of A14 DNA was 485 pM. | N/A | Fluorescence Resonance Energy Transfer Assay (FRET) | 4 ± 2 nM | Detection | N/A | 5'-Cyanine3 (Cy3) Labeled or 5'-Biotinylated and 5′ end by six nucleotides (ACT GTC) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1785 | https://doi.org/10.1016/j.cclet.2022.108102 | 2023 | Rapid detection of pathogenic bacteria based on a universal dual-recognition FRET sensing system constructed with aptamer-quantum dots and lectin-gold nanoparticles | Aptamer | ATCCGTCACACCTGCTCTATCAAATGTGCAGATATCAAGACGATTTGTACAAGATGGTGTTGGCTCCCGTAT | 72 | N/A | ssDNA | Escherichia Coli (E. Coli) (CICC 21530) | Whole cell | Developed a dual-recognition-based sandwich FRET sensor using Aptamer-QDs and Con A-AuNPs for the detection of E. coli. | Achieved a linear detection range from 10(2) cfu/mL to 2 × 10(8) cfu/mL with the detection limit of 45 cfu/mL for E. coli, and LOD in the milk and orange juice was 300 cfu/mL and 200 cfu/mL, respectively. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1786 | https://doi.org/10.1016/j.snb.2023.133745 | 2023 | Dual recognition strategy for the rapid and precise detection of Bacillus cereus using post-modified nano-MOF and aptamer | Aptamer | AGCAGCACAGAGGTCAGATGCCCCCCTTTTATCCGTCGGCATGATGTCTCCCGATCCGGTCCTATGCGTGCTA | 73 | N/A | ssDNA | Bacillus Cereus (CICC 10041) | Whole cell | A dual-recognition strategy using a fluorescent probe, FcMBL-coated nano-MIL-53(Al)-NH2, for detecting B. cereus was developed. | Shows a linear range of 20–2 × 10(8) CFU/mL with a limit of detection of 4 CFU/mL within 60 min. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated and 5'-FITC Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1792 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt (mono-apt) | GAGAGAGAATATAAGGGAAAAAAAAAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 82 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | N/A | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 389.63 nM (with mono-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1793 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt1 (multi-apt) | GAAGTGTACGTAGCCTGATTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1794 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt2 (multi-apt) | TCGTCTACACTACTGCTCTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1795 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt3 (multi-apt) | TCTCCAATGACGTACCTGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1796 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt4 (multi-apt) | GTTGCAGTACTCTACGAGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1797 | https://doi.org/10.1016/j.snb.2022.132860 | 2023 | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | Apt5 (multi-apt) | TGTACTGGACAAGTGACGTTAAAAAAAAAAAAGTCAACACGAGAGGAGGGGAGTGGAATCAGGATAGGTGTGTAGGG | 77 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a hybridization chain reaction (HCR) based multivalent aptamer (multi-Apt) as an effective signal amplifier for the sensitive detection of Salmonella. | Could detect Salmonella with multi-apt as low as 7 cfu/mL with a broad detection range of 10 to 10(7) cfu/mL. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.72 nM (with multi-apt) | Biosensor | N/A | 5'-Biotinylated and 5'-FAM Labeled | N/A | The signals generated by the multi-Apt amplifier with different storage times at 4°C have remained unchanged over the past month. | N/A | N/A | N/A |
| ABdb_1812 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt1 | GAAGTGTACGTAGCCTGATTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 60 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1813 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt2 | TACTGCTCTTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 50 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1814 | 37893744 | 2023 | A Colorimetric/Fluorescent Dual-Mode Aptasensor for Salmonella Based on the Magnetic Separation of Aptamers and a DNA-Nanotriangle Programmed Multivalent Aptamer | Apt3 | CGTACCTGTTCTTGGGCGGTTGGTGTGATGGGCTTTTTTCGTTGGGCCGG | 50 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | Developed a colorimetric/fluorescent dual-mode method based on a DNA-nanotriangle programmed multivalent aptamer (NTri-Multi-Apt) for the detection of Salmonella. | Achieved a linear range of 1.0 × 10(2)–1.0 × 10(7) CFU/mL and LODs of 316 and 60 CFU/mL for colorimetric and fluorescent detection, respectively. | N/A | Enzyme-Linked Immunosorbent Assay (ELISA) | 11.89 nM | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1826 | https://doi.org/10.1016/j.microc.2023.108681 | 2023 | An electrochemical and colorimetric dual-mode aptasensor for Staphylococcus aureus based on a multifunctional MOF and magnetic separation technique | S. aureus Aptamer | GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA | 88 | N/A | ssDNA | Staphylococcus aureus (S. aureus) (ATCC 25923) | Whole cell | Developed a colorimetric and electrochemical dual-mode aptasensor based on ssDNA-Au/CuMOF and MB-Apt for S. aureus detection. | Display a broad linear range from 10 to 10(8) CFU/mL, with colorimetric minimum resolution of 48 CFU/mL, and electrochemical detection limit of 5 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1827 | 37311299 | 2023 | Joint concanavalin A-aptamer enabled dual recognition for anti-interference visual detection of Salmonella typhimurium in complex food matrices | S. typhimurium aptamer | TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG | 40 | N/A | ssDNA | Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) | Whole cell | A dual recognition platform based on Concanavalin A (Con A)-aptamer joint strategy for sensitive determination of S. typhimurium. | Exhibited linear range of 7.0 × 10(1) ∼ 7.0 × 10(9) CFU/mL, along with a detection limit as low as 23 CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1850 | https://doi.org/10.1016/j.electacta.2024.144240 | 2024 | Label-free electrochemical aptasensor for detection of Acinetobacter baumannii: Unveiling the kinetic behavior of reduced graphene oxide v/s graphene oxide | Aptamer | ACAGCACCACAGACCACATATCACATGCTGTCGCCTTGCGATATCAATTCCAGTGATGTTTGTCTTCCTGCC | 72 | N/A | ssDNA | Acinetobacter Baumannii (ATCC BAA-2800) | Whole cell | Developed an electrochemical aptasensor that employed a screen-printed carbon electrode modified with both graphene oxide (GO) and reduced graphene oxide (rGO) for the detection of AB. | Achieved an impressive limit of detection of 10 CFU/mL and a linear range of 10 to 10(9) CFU/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | The current response of aptasensor exhibited negligible changes in the CV signal even after the 4-week storage period. | N/A | N/A | N/A |
| ABdb_1884 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-6 | GCTGCAATACTCATGGACAGCACGGCACGGGCTGTCGATCTCGAGGGAAACGGCACATGTGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Outer membrane protein BamA (β-barrel assembly machinery A) | Identify aptamers against Brucella and conjugate them to liposomes for selective recognition and significantly reduced bacterial invasion of host cells. | WS-6 significantly reduced Brucella invasion, as evidenced by a decrease in qPCR Ct from 22.34 to 20.64 (P < 0.05), confirming a reduced intracellular bacterial load. | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 16.23 ± 5.84 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | The aptamer demonstrated stable binding to the Brucella S2 vaccine across a temperature range of 16–50°C, with optimal binding observed between 16°C and 50°C and under neutral conditions (pH 7.6) in 2h. | Best Candidate | N/A | N/A |
| ABdb_1885 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-26 | GCTGCAATACTCATGGACAGCGGAACGCTGTCTCCTCATTCAATCTAGGAGTCTGCGTGAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 20.33 ± 8.12 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1886 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-17 | GCTGCAATACTCATGGACAGGACAACGTCCTGTACCAGCGCTACGCCAGATCAGTTTTAGGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 17.11 ± 6.35 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1887 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-32 | GCTGCAATACTCATGGACAGGGGACTCAGGTCCCCGGGAGCGCAATGGTGGGGTTTTAATGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 13.08 ± 2.97 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1888 | 40451960 | 2025 | Screening and characterization of nucleic acid aptamers targeting Brucella surface antigens: identification and analysis of their corresponding binding sites | WS-44 | GCTGCAATACTCATGGACAGGGACCTGTCCCTGGCCTCTTAGGGTAAAATTTTGCCACAAGTCTGGAGTACGACCCTGAA | 80 | N/A | ssDNA | Brucella S2 vaccine strain | Whole cell | Binds BamA β-barrel assembly protein → blocks/inhibits bacterial invasion into host cells. | N/A | 13 | Indirect Enzyme-Linked Aptamer Assay (i-ELAA) | 15.03 ± 4.2 nM | Therapeutics | Whole Cell-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1889 | 39894103 | 2025 | Introduce a novel, extremely sensitive aptamer against staphylococcal enterotoxin type D | Aptamer 1 | CCTAACCGATATCACACTCAC-GGGTGCAGCCCGGAGCGGCTTGCATGATTGGGTTGGTGGG-GTTGGTCGTCATTGGAGTATC | 82 | 5'-CCTAACCGATATCACACTCAC-N40-GTTGGTCGTCATTGGAGTATC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin D (SED) | Isolate high-affinity ssDNA aptamers with specificity for SED. | The limit of detection (LOD) for SED was determined to be 45 nM. | 10 | Surface Plasmon Resonance (SPR) and Enzyme-Linked Apta-Sorbent Assay (ELASA) | 4.4 ± 2.26 nM (by SPR) and 13.43 nM (by ELASA) | Diagnostic | Whole Cell-SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1896 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S8 | CGTACGGTCGACGCTAGC-ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1897 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S10 | CGTACGGTCGACGCTAGC-ACCAGCCATAGTCACATCAAAACTAACTCACATTC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1898 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S12 | CGTACGGTCGACGCTAGC-CCCATACTCATCACCATTCACATCACTCACCTAGC-CACGTGGAGCTCGGATGC | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1899 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S1 | GGATCCGAGCTCCACGTG-GCTAGGTGAGTGATGTGAATGGTGATGAGTATGGG-GCTAGCGTCGACCGTACG | 71 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S1, the Ru-modified oligonucleotide, bound S. pneumoniae R6 with slightly lower affinity than S9. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 125 ± 91 nM | Detection | SELEX and Mod-SELEX | T=dURu(bpy)TP1, 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1900 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S9 | ACACCCCCCAGGATCATAAATTCTCTCGCTGTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S9 bound better to the bacterial target than the modified sequence S1. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 118 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | Best Candidate | N/A | N/A |
| ABdb_1901 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S11 | ACCAGCCATAGTCACATCAAAACTAACTCACATTC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | S11 exhibited a lower propensity at binding to the bacterial target. | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | 541 ± 1 nM | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1902 | 41205160 | 2025 | Selection of Ruthenium Polypyridyl Complex-Modified Aptamers for Photodynamic Therapy against Streptococcus Pneumonia | S13 | CCCATACTCATCACCATTCACATCACTCACCTAGC | 35 | 5'-CGTACGGTCGACGCTAGC-35N-CACGTGGAGCTCGGATGC-3' | ssDNA | Streptococcus Pneumoniae R6 | Whole cell | Aptamer-functionalized ruthenium polypyridyl complexes against S. pneumoniae with targeted photodynamic therapy (PDT). | N/A | 10 rounds (with standard DNA chemistry) and 12 (for the mod-SELEX) | Flow Cytometry | N/A | Detection | SELEX and Mod-SELEX | 5'-Biotinylated and 5'-FAM Labeled | N/A | N/A | N/A | N/A | N/A |
| ABdb_1903 | 41339596 | 2025 | Self-reduced Pd nanoparticles on NiMn-LDHs with superior catalytic activity for signal amplification in electrochemical aptasensing of Mycobacterium tuberculosis ESAT-6 antigen | Apt | GGGAGCTCAGAATAAACGCTCAACCTCCCTGGGTCACCATAGACTCCATCTAAGATGCTTCGACATGAGGCCCGGATC | 78 | N/A | ssDNA | Mycobacterium Tuberculosis (M.Tb.) | ESAT-6 (6-kDa early secretory antigenic target) | Developed an electrochemical aptasensor using NiMn-layered double hydroxides@palladium nanoparticles (NiMn-LDHs@PdNPs) for detecting the ESAT-6 antigen in human serum. | The aptasensor exhibited a wide linear detection range of 75 pg/mL to 10 ng/mL with a low limit of detection (LOD) of 0.629 pg/mL. | N/A | N/A | N/A | Biosensor | N/A | 5'-Amidation (NH₂-(CH2)6) and 5'-Biotinylated | N/A | Aptasensor was stored at 4°C for and after 30 days, the current remained approximately 80% of the initial value. | N/A | N/A | N/A |
| ABdb_1951 | 10451913 | 1999 | In vitro selection of DNA aptamers to anthrax spores with electrochemiluminescence detection | Aptamer pool | N/A | N/A | N/A | ssDNA | Bacillus Anthracis (BA) | Anthrax spores | Develop an aptamer–magnetic bead-electrochemiluminescence (AM-ECL) sandwich assay for detecting anthrax spores. | Display broad dynamic range equivalent to 10– 6×10(6) anthrax spores. | 4 | ECL-based and Colorimetric Peroxidase-Based Aptamer Plate Binding Assay | N/A | Detection | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_1952 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-cholera whole toxin aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Vibrio Cholerae | Cholera toxin | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 40 ng in the cholera electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1953 | 11808691 | 2002 | Use of magnetic beads in selection and detection of biotoxin aptamers by electrochemiluminescence and enzymatic methods | Anti-staphylococcal enterotoxin B (SEB) aptamers | N/A | N/A | 5'-CCGGATCCGTTGATA-N20-GTGGTGTTGGCTCCC-3' | ssDNA | Staphylococcus aureus (S. aureus) | Staphylococcal Enterotoxin B (SEB) | Developed an aptamer-based electrochemiluminescence assay using a dsDNA aptamer for biotoxin detection. | Detection limit of less than 10 pg SEB with electrochemiluminescence assay. | 5 | N/A | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated (for ECL) or 5'-Amidation (NH₂-(CH2)6) (for colorimetric assays) | N/A | N/A | N/A | N/A | N/A |
| ABdb_1954 | 16550191 | 2006 | Anti-Francisella tularensis DNA aptamers detect tularemia antigen from different subspecies by Aptamer-Linked Immobilized Sorbent Assay | Aptamer cocktail | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Francisella Tularensis subspecies (subsp) Japonica | Tularemia Bacterial Antigen | Identify aptamers that bind specifically to the tularemia bacterial antigen from the subspecies japonica or holarctica. | The detection limit for the aptamer cocktail is 25 ng (1.7 × 10^3/ml of bacteria). | 10 | Aptamer-Linked Immobilized Sorbent Assay (ALISA) | N/A | Biosensor | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2009 | https://doi.org/10.1016/j.lwt.2013.12.012 | 2014 | Development and evaluation of aptamer magnetic capture assay in conjunction with real-time PCR for detection of Campylobacter jejuni | Aptamer 229 | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (A9a) | Whole cell | Develop an aptamer-based magnetic capture-qPCR (AMC-qPCR) assay for the detection of Campylobacter jejuni. | Capture efficiency was 10–13% at the detection limit of 1.1 log10/300 μl C. jejuni cells and a range of 1.0–2.0 log10 CFU per sample (0.3-10 ml). | N/A | N/A | N/A | Detection | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | WO Patent WO/2011/097420 |
| ABdb_2012 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-27 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2013 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-33 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-33 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2014 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-36 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | AT-36 inhibited α-toxin-induced upregulation of TNF-α and IL-17 in Jurkat T cells. Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2015 | 24472539 | 2014 | DNA aptamers as a novel approach to neutralize Staphylococcus aureus α-toxin | AT-49 | N/A | N/A | 5'-ACCCCTGCAGGATCCTTTGCTGGTACC-N42-AGTATCGCTAATCAGTCTAGAGGGCCCCAGAAT-3' | ssDNA | Staphylococcus aureus (S. aureus) | α-toxin (exotoxin) | Identify aptamers that bind to and inhibit the cytotoxic activity of a-toxin and the upregulation of inflammatory cytokines TNF-a and IL-17. | Increased the viability of α-toxin-treated Jurkat T cells to about 85–90%. | 10 | N/A | N/A | Therapeutics/Immunmodulatory | SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | N/A |
| ABdb_2016 | 25511112 | 2015 | Development of a fluorescent enzyme-linked DNA aptamer-magnetic bead sandwich assay and portable fluorometer for sensitive and rapid listeria detection | LLO-3 | N/A | N/A | 5'-ATCCGTCACACCTGCTCT-N36-TGGTGTTGGCTCCCGTAT-3' | ssDNA | Listeria Monocytogenes (ATCC 19115) | Listeriolysin O (LLO) protein | A fluorescent DNA aptamer-magnetic bead sandwich assay was developed to detect LLO protein. | Demonstrated LODs in the range of 4 to 61 L. monocytogenes cells or the equivalent LLO produced by 4 to 61 cells on average in a separate titration trial. | 8 | Enzyme-Linked Immunosorbent Assay (ELISA)-like Aptamer Microplate Affinity Ranking (ELASA) | N/A | Biosensor | Magnetic Bead (MB)-based SELEX | 5'-Biotinylated | N/A | N/A | N/A | N/A | Patent filled |
| ABdb_2117 | 28342148 | 2017 | Further characterization and independent validation of a DNA aptamer-quantum dot-based magnetic sandwich assay for Campylobacter | Aptamer | N/A | N/A | N/A | ssDNA | Campylobacter Jejuni (ATCC 29428) | Whole cell | Developed an aptamer-MB and aptamer-QD sandwich assay for the detection of C.jejuni. | Establishes a LOD between 5 and 10 C. jejuni cells/mL in sterile buffer (PBS) and chicken rinsate. | N/A | N/A | N/A | Biosensor | N/A | 5'-Biotinylated | N/A | N/A | N/A | N/A | U.S. Patent No. 9562900 |