Modification : 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled and 5'-Biotinylated

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_0458	25188392	2014	Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella Typhimurium	STM-binding aptamer	ATCCGTCACACCTGCTCTGGAGCAATATGGTGGAGAAACGTGGTGTTGGCTCCCGTAT	58	N/A	ssDNA	Salmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115)	Whole cell	Develop a gold nanoparticle-based enzyme-linked antibody-aptamer sandwich (nano-ELAAS) method for quantitative detection of STM.	Quantitative detection range: 1 × 10³ to 1 × 10⁸ CFU/mL and LOD: 1 × 10³ CFU/mL, and a selectivity of >10-fold for STM in samples containing other bacteria at higher concentration, with an assay time of less than 3 h.	N/A	LPS-Aptamer Plate Binding Assay	19.59 ± 0.35 nM	Biosensor	N/A	5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled and 5'-Biotinylated	N/A	MMP-aptamers and nanoprobes were stored at 4°C for 2 weeks, no obvious change of the S/B was observed.	N/A	N/A	N/A