AptBacterialDB

Modification : 5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled

Total records found: 3

Download:

Search:
AptBacDB_ID ⇅ PMID/DOI ⇅ Year ⇅ Title ⇅ Aptamer name ⇅ Sequence (5′ to 3′) ⇅ Length ⇅ Library ⇅ Type ⇅ Target Organism ⇅ Target ⇅ Objective/Mechanism ⇅ Outcome/Inhibitory effect ⇅ No. of selection round SELEX ⇅ Determination of affinity method ⇅ Kd value ⇅ Activity Role ⇅ Method ⇅ Modification ⇅ Cytotoxicity (cell viability) ⇅ Stability⇅ Potential Candidate ⇅ Half-life ⇅ Patent ⇅
ABdb_0458 251883922014Gold nanoparticle-based enzyme-linked antibody-aptamer sandwich assay for detection of Salmonella TyphimuriumSTM-binding aptamerATCCGTCACACCTGCTCTGGAGCAATATGGTGGAGAAACGTGGTGTTGGCTCCCGTAT58N/AssDNASalmonella Typhimurium (S. Typhimurium) (ATCC 14028) (CMCC 50115)Whole cellDevelop a gold nanoparticle-based enzyme-linked antibody-aptamer sandwich (nano-ELAAS) method for quantitative detection of STM.Quantitative detection range: 1 × 10³ to 1 × 10⁸ CFU/mL and LOD: 1 × 10³ CFU/mL, and a selectivity of >10-fold for STM in samples containing other bacteria at higher concentration, with an assay time of less than 3 h.N/ALPS-Aptamer Plate Binding Assay19.59 ± 0.35 nMBiosensorN/A5'-Amidation (NH₂-(CH2)6) and 5'-FITC Labeled and 5'-BiotinylatedN/AMMP-aptamers and nanoprobes were stored at 4°C for 2 weeks, no obvious change of the S/B was observed.N/AN/AN/A
ABdb_1180 322548372018Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tagsSa1GCAATGGTACGGTACTTCCACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCGCAAAAGTGCACGCTACTTTGCTAA88N/AssDNAStaphylococcus aureus (S. aureus)Whole cellDevelop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus.The LOD of the platform was 20 cells/mL for S. aureus, with a capture efficiency of up to 88.89% within 15 min.N/AN/AN/ABiosensorN/A5'-Amidation (NH₂-(CH2)6) and 5'-FITC LabeledN/AN/AN/AN/AN/A
ABdb_1787 371964082023A SERS bioassay based on vancomycin-modified PEI-interlayered nanocomposite and aptamer-functionalized SERS tags for synchronous detection of Acinetobacter baumannii and Klebsiella pneumoniaeK2AATCAGGCTCAGCATGGAGTTGCGAGGCCAATATCCGGTTAAGCG45N/AssDNAKlebsiella Pneumoniae (KP)Whole cellA double-edged sword SERS aptasensor was developed using SPION-PEI-Au-Van nanocomposites for synchronous detection of K. pneumoniae and A. baumannii in food and clinical samples.Shows a limit of detection was 10 cells/mL with a linear range of 50-10(5) cells/mL for both KP and AB.N/AN/A5.377 nMBiosensorN/A5'-Amidation (NH₂-(CH2)6) and 5'-FITC LabeledN/AN/AN/AN/AN/A