Modification : 5'-Amidation (NH₂-(CH2)6) and 5'-Cyanine3 (Cy3) Labeled

Total records found: 1

Download:

Search:

AptBacDB_ID ⇅	PMID/DOI ⇅	Year ⇅	Title ⇅	Aptamer name ⇅	Sequence (5′ to 3′) ⇅	Length ⇅	Library ⇅	Type ⇅	Target Organism ⇅	Target ⇅	Objective/Mechanism ⇅	Outcome/Inhibitory effect ⇅	No. of selection round SELEX ⇅	Determination of affinity method ⇅	Kd value ⇅	Activity Role ⇅	Method ⇅	Modification ⇅	Cytotoxicity (cell viability) ⇅	Stability⇅	Potential Candidate ⇅	Half-life ⇅	Patent ⇅
ABdb_1181	32254837	2018	Sensitive and specific detection of clinical bacteria via vancomycin-modified Fe3O4@Au nanoparticles and aptamer-functionalized SERS tags	E1	GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA	88	N/A	ssDNA	Escherichia Coli (E. Coli)	Whole cell	Develop a dual-recognition SERS platform using vancomycin-modified Fe3O4@Au magnetic nanoparticles (Fe3O4@Au-Van MNPs) for the detection of E. coli and S. aureus.	The LOD of the platform was 50 cells/mL for E. coli, and capture efficiency reached 74.96% within 15 min.	N/A	N/A	N/A	Biosensor	N/A	5'-Amidation (NH₂-(CH2)6) and 5'-Cyanine3 (Cy3) Labeled	N/A	N/A	N/A	N/A	N/A